Difference between revisions of "Sequence DNA for Bio113"

Revision as of 20:55, 15 November 2017

Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence

1. For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
2. Add water to your DNA until the combined volume is 8 µL.
3. To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
4. Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.

Sequencing Primers to confirm Inserts v2.0
113_pClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream first base


113_rClone_SeqFor
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream first base


113_actClone_SeqFor
GCATTAGAAACCGTCCATCG Tm = 64° C 73bp upstream first base
113_actClone SeqRev
CCATTAGAAACCATCCCTCG Tm = 63° C 119bp downstream first base


113_repClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 65bp upstream first base