Difference between revisions of "Sequence DNA for Bio113"

From GcatWiki
Jump to: navigation, search
(Created page with " == Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence == # For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded s...")
 
 
(12 intermediate revisions by 2 users not shown)
Line 4: Line 4:
 
# Add water to your DNA until the combined volume is 8 µL.  
 
# Add water to your DNA until the combined volume is 8 µL.  
 
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
 
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 eXperimental sequencing reactions to send away. Those working with actClone will have 6 tubes to send away.  
+
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.  
  
  
 
----
 
----
  
'''Sequencing Primers to confirm Inserts v2.0'''
+
'''Sequencing Primers to confirm Inserts v2.0'''<br>
113_pClone_SeqFor<br>
+
113_pClone_Red_SeqFor (called pClone_Red_Fwd3 in SnapGene file)<br>
CTAATTCAACAAGAATTGGGAC Tm = 60 C  65bp upstream first base<br>
+
'''GTGCAAATAAATTTAAGGGTAAG''' Tm = 51°C as per SnapGene; 151bp upstream of first base of the sticky end<br>
 +
This new primer gave good results for every reaction. Previous sequencing primer was too close to the insert and most of the new promoters were not readable.
 
<br>
 
<br>
 
<br>
 
<br>
113_rClone_SeqFor <br>
+
<hr>
AACGTGCTGAAGGTCGTC Tm = 65 C  60bp upstream first base<br>
+
<hr>
 
<br>
 
<br>
 
<br>
 
<br>
113_actClone_SeqFor<br>
+
113_rClone_Red_SeqRev <br>
GCATTAGAAACCGTCCATCG Tm = 64 C 73bp upstream first base<br>
+
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part<br>
113_actClone SeqRev<br>
 
CCATTAGAAACCATCCCTCG Tm = 63 C 107bp upstream first base<br>
 
 
<br>
 
<br>
 
<br>
 
<br>
113_repClone_SeqFor<br>
+
113_pClone_mScarlet_SeqFor<br>
ACAGCTCTTCGCCTTTAC Tm = 62 C 93bp upstream first base<br>
+
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part<br>
 +
<br>
 +
<br>
 +
113_rClone_mScarlet_SeqRev<br>
 +
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part<br>
 
<br>
 
<br>
 
<br>
 
<br>

Latest revision as of 19:53, 1 December 2020

Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence

  1. For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
  2. Add water to your DNA until the combined volume is 8 µL.
  3. To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
  4. Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.



Sequencing Primers to confirm Inserts v2.0
113_pClone_Red_SeqFor (called pClone_Red_Fwd3 in SnapGene file)
GTGCAAATAAATTTAAGGGTAAG Tm = 51°C as per SnapGene; 151bp upstream of first base of the sticky end
This new primer gave good results for every reaction. Previous sequencing primer was too close to the insert and most of the new promoters were not readable.





113_rClone_Red_SeqRev
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part


113_pClone_mScarlet_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part


113_rClone_mScarlet_SeqRev
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part