Difference between revisions of "PCR for Bio113"

From GcatWiki
Jump to: navigation, search
(Created page with "==Transformations after GGA== You want to do 3 transformations:<br> # a positive control that contains known [http://partsregistry.org/Part:BBa_J04450 PlacI + RBS + RFP] to be...")
 
(→‎PCR Verification of Successful GGA)
 
(22 intermediate revisions by 2 users not shown)
Line 1: Line 1:
−
==Transformations after GGA==
+
==PCR Verification of Successful GGA==
−
You want to do 3 transformations:<br>
+
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).  
−
# a positive control that contains known [http://partsregistry.org/Part:BBa_J04450 PlacI + RBS + RFP] to be used for comparison RFP expression. <br>
+
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
−
# your experimental GGA ligation<br>
+
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.  
−
# your negative control "GGA plasmid only" ligation.<br><br>
+
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.  
−
Use all 10 µL of the ligations for a [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transformation]. <br>
+
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.  
−
[http://partsregistry.org/Part:BBa_J04450 J04450] is a transformation positive control because it contains PlacI+RBS+RFP in plasmid pSB1A2. <br>  <br>
+
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:
  
−
Pipet 40 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transformations] listed above. Plate all three transformations (with SOC) on LB amp plates.<br>  <br>
+
----
  
−
==PCR Verification of Successful GGA==
+
# 95° C for 5 minutes, 1 time
−
If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).  
+
# 95° C for 30 seconds
−
# Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
+
# 54° C for 30 seconds
−
# Use these two primers:
+
#72° C for 30 seconds
−
* Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
+
# return to step #2 29 more times
−
* Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
+
# store at 22° C indefinitely
−
* PCR product with the original TT still in place is 251 bp
+
 
−
* size of TT that should be removed by GGA is 107 bp
+
* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.
 +
 
 +
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==
 +
'''J119137; pClone Red  (remove 70 bp, insert <61 bp)'''<br>
 +
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C<br>
 +
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C<br>
 +
177 bp amplicon for J119137<br>
 +
167 bp amplicon for 60 bp insertion<br>
 +
<br>
 +
<br>
 +
'''J100384; pClone mScarlet  (remove 70 bp, insert <61 bp)'''<br>
 +
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C<br>
 +
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C<br>
 +
228 bp amplicon for J100384<br>
 +
220 bp amplicon for 60 bp insertion<br>
 +
<br>
 +
<br>
 +
'''J119384; rClone Red (remove 819 bp, insert <61 bp)'''<br>
 +
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C<br>
 +
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C<br>
 +
856 bp amplicon for J119384<br>
 +
58 bp amplicon for 15 bp insertion <br>
 +
<br>
 +
<br>
 +
'''J100419; rClone mScarlet (remove 819 bp, insert <61 bp)'''<br>
 +
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C<br>
 +
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C<br>
 +
914 bp amplicon for J100419<br>
 +
95 bp amplicon for 15 bp insertion <br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
 
 +
'''Previous plasmids used in 113'''<br>
 +
'''J100204; actClone Red (remove 119 bp, insert <61 bp)'''<br>
 +
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C<br>
 +
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG  Tm = 61 C<br>
 +
250 bp amplicon for J100204 <br>
 +
<br>
 +
<br>
 +
'''J100205; repClone Red (remove 129 bp, insert <61 bp)'''<br>
 +
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C<br>
 +
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C<br>
 +
424 bp amplicon for J100205<br>
 +
<br>
 +
<br>

Latest revision as of 12:02, 15 September 2022

PCR Verification of Successful GGA

If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).

  1. For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
  2. Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
  3. Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.
  4. The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.
  5. Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:
  1. 95° C for 5 minutes, 1 time
  2. 95° C for 30 seconds
  3. 54° C for 30 seconds
  4. 72° C for 30 seconds
  5. return to step #2 29 more times
  6. store at 22° C indefinitely
  • When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.

PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

J119137; pClone Red (remove 70 bp, insert <61 bp)
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C
177 bp amplicon for J119137
167 bp amplicon for 60 bp insertion


J100384; pClone mScarlet (remove 70 bp, insert <61 bp)
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C
228 bp amplicon for J100384
220 bp amplicon for 60 bp insertion


J119384; rClone Red (remove 819 bp, insert <61 bp)
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C
856 bp amplicon for J119384
58 bp amplicon for 15 bp insertion


J100419; rClone mScarlet (remove 819 bp, insert <61 bp)
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C
914 bp amplicon for J100419
95 bp amplicon for 15 bp insertion






Previous plasmids used in 113
J100204; actClone Red (remove 119 bp, insert <61 bp)
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C
250 bp amplicon for J100204


J100205; repClone Red (remove 129 bp, insert <61 bp)
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C
424 bp amplicon for J100205


Retrieved from "https://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&oldid=19295"