Difference between revisions of "Oligo design for XOR Hybrid Promoters"
m |
|||
| Line 6: | Line 6: | ||
This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG. | This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG. | ||
| − | Design features: | + | '''Design features: ''' |
Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter. | Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter. | ||
| Line 51: | Line 51: | ||
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. | This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. | ||
| − | Design features: | + | '''Design features:''' |
Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence. | Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence. | ||
Revision as of 20:45, 17 June 2008
Oligo design for XOR Hybrid Promoters
Mnt/LacI hybrid promoter This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG.
Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter.
Biobrick prefix gaattcgcggccgcttctagag
Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
LacI last 35bp (everything after -10) tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt
Biobrick suffix tactagtagcggccgctgcag
Entire sequence 138bp
Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc
Primers (78bp)
Forward gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
Reverse (reverse complement) gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatctaggt
Mnt/TetR hybrid promoter
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc.
Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence.
Biobrick prefix gaattcgcggccgcttctagag
Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
tetR1 tccctatcagtgatagaga
Spacer actgta
TetR 2 binding site atccctatcagtgatagagat
Biobrick suffix tactagtagcggccgctgcag
Entire sequence 143bp
Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc
Primers (81bp)
Forward gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag
Reverse (reverse complement) gcatctgcagcggccgctactagtaatctctatcactgatagggattctctatcactgatagggaactataggagatct