Difference between revisions of "Missing tRNA-trp gene found"
From GcatWiki
| Line 5: | Line 5: | ||
<br> | <br> | ||
Evidence:<br> | Evidence:<br> | ||
| − | '' | + | Similarity with ''Haloarcula marismortui tRNA-trp''<br> |
Score = 163 bits (82), Expect = 4e-41 | Score = 163 bits (82), Expect = 4e-41 | ||
Identities = 159/181 (87%), Gaps = 4/181 (2%) | Identities = 159/181 (87%), Gaps = 4/181 (2%) | ||
Strand = Plus / Minus | Strand = Plus / Minus | ||
Revision as of 15:06, 23 September 2008
tRNA-trp-CCA:
DNA Coordinates: 465777..465601
GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAGAGGCACCGCGCCCGGGACGACACTCCAGACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCAACCGGAGATATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA
Evidence:
Similarity with Haloarcula marismortui tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%) Strand = Plus / Minus
