Difference between revisions of "Missing tRNA-trp gene found"
| Line 1: | Line 1: | ||
| − | ''' | + | '''tRNA-trp-CCA:'''<br> |
| − | |||
| − | '''<br> | ||
DNA Coordinates: 465601..465777 (-)<br> | DNA Coordinates: 465601..465777 (-)<br> | ||
<br> | <br> | ||
Revision as of 15:17, 23 September 2008
tRNA-trp-CCA:
DNA Coordinates: 465601..465777 (-)
GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAGAGGCACCGCGCCCGGGACGACACTCCAG
ACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCA
ACCGGAGATATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA
Evidence:
Similarity with Haloferax volcanii tRNA-trp
Score = 190 bits (96), Expect = 2e-49
Identities = 155/172 (90%), Gaps = 2/172 (1%)
Similarity with Halobacterium salinarum R1 tRNA-trp
Score = 174 bits (88), Expect = 1e-44
Identities = 154/172 (89%), Gaps = 3/172 (1%)
Similarity with Haloarcula marismortui tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)
Similarity with Natronomonas pharaonis tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)