Difference between revisions of "Missing tRNA-trp gene found"
| Line 24: | Line 24: | ||
Score = 163 bits (82), Expect = 4e-41<br> | Score = 163 bits (82), Expect = 4e-41<br> | ||
Identities = 159/181 (87%), Gaps = 4/181 (2%)<br> | Identities = 159/181 (87%), Gaps = 4/181 (2%)<br> | ||
| + | <br> | ||
| + | [http://www.jbc.org/cgi/content/abstract/263/34/17951]: "A tRNA-trp Intron Endonuclease from ''Halobacterium volcanii''"(I was unable to upload the pdf for this paper, you can download it at this site) | ||
Revision as of 14:11, 25 September 2008
tRNA-trp-CCA:
DNA Coordinates: 465601..465777 (-)
GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAGAGGCACCGCGCCCGGGACGACACTCCAG
ACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCA
ACCGGAGATATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA
Evidence:
Similarity with Haloferax volcanii tRNA-trp
Score = 190 bits (96), Expect = 2e-49
Identities = 155/172 (90%), Gaps = 2/172 (1%)
Similarity with Halobacterium salinarum R1 tRNA-trp
Score = 174 bits (88), Expect = 1e-44
Identities = 154/172 (89%), Gaps = 3/172 (1%)
Similarity with Haloarcula marismortui tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)
Similarity with Natronomonas pharaonis tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)
[1]: "A tRNA-trp Intron Endonuclease from Halobacterium volcanii"(I was unable to upload the pdf for this paper, you can download it at this site)
