|
|
| (26 intermediate revisions by 3 users not shown) |
| Line 1: |
Line 1: |
| − | == Found on CRISPRFInder: ==
| + | [[Direct Repeats]] |
| | | | |
| − | '''Two confirmed CRISPRs:'''
| + | [[Blasting Spacers for Our Genome]] |
| | | | |
| − | CRISPR id : tmp_1_Crispr_12
| + | [[Spacers for Other Species]] |
| − | START crispr position : 2723382 </br>
| |
| − | END crispr position : 2725579 </br>
| |
| − | Crispr length : 2197 </br>
| |
| − | DR consensus : GTTTCAGACGGACCCTTGTGGGATTGAAGC DR length : 30</br>
| |
| − | Number of spacers : 33</br>
| |
| | | | |
| − | CRISPR id : tmp_2_Crispr_1</br>
| + | [[Blasting Spacers for Haloferax mediterranei]] |
| − | START crispr position : 31920</br>
| |
| − | END crispr position : 34849</br>
| |
| − | Crispr length : 2929</br>
| |
| − | DR consensus : GCTTCAATCCCACAAGGGTCCGTCTGAAAC DR length : 30</br>
| |
| − | Number of spacers : 44</br>
| |
| | | | |
| − | '''11 Questionable CRISPRs:'''
| + | [[CRISPR-associated Proteins]] |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_1 | |
| − | START crispr position : 451036
| |
| − | END crispr position : 451146
| |
| − | Crispr length : 110
| |
| − | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25
| |
| − | Number of spacers : 1
| |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_2
| |
| − | START crispr position : 451266
| |
| − | END crispr position : 451422
| |
| − | Crispr length : 156
| |
| − | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25
| |
| − | Number of spacers : 2
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_3
| |
| − | START crispr position : 723910
| |
| − | END crispr position : 724040
| |
| − | Crispr length : 130
| |
| − | DR consensus : CCGCCCGAACACGCCGGTCCCGACCACGAGAACGAGAC DR length : 38
| |
| − | Number of spacers : 1
| |
| − | | |
| − | RISPR id : tmp_1_PossibleCrispr_4
| |
| − | START crispr position : 775514
| |
| − | END crispr position : 775595
| |
| − | Crispr length : 81
| |
| − | DR consensus : TGATTCGCCCAGCGAGCGCGTTCGTG DR length : 26
| |
| − | Number of spacers : 1
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_5
| |
| − | START crispr position : 1587713
| |
| − | END crispr position : 1587871
| |
| − | Crispr length : 158
| |
| − | DR consensus : TCGAAGGGGCTGTCGCTGTCGGTG DR length : 24
| |
| − | Number of spacers : 2
| |
| − | | |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_6
| |
| − | START crispr position : 1635784
| |
| − | END crispr position : 1635940
| |
| − | Crispr length : 156
| |
| − | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25
| |
| − | Number of spacers : 2
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_7
| |
| − | START crispr position : 1733154
| |
| − | END crispr position : 1733268
| |
| − | Crispr length : 114
| |
| − | DR consensus : GTTCGCCGGACCGTGTGGGTGTCG DR length : 24
| |
| − | Number of spacers : 2
| |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_8
| |
| − | START crispr position : 2087618
| |
| − | END crispr position : 2087725
| |
| − | Crispr length : 107
| |
| − | DR consensus : AGCGCCGGGCGACGACGGGCCAGC DR length : 24
| |
| − | Number of spacers : 1
| |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_9
| |
| − | START crispr position : 2127953
| |
| − | END crispr position : 2128039
| |
| − | Crispr length : 86
| |
| − | DR consensus : CGCTCGCTTCGAGGGCCGACACTCGCT DR length : 27
| |
| − | Number of spacers : 1
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_10
| |
| − | START crispr position : 2206888
| |
| − | END crispr position : 2206968
| |
| − | Crispr length : 80
| |
| − | DR consensus : CAGTCCAGTGAGGCGTCTCGTCGTCG DR length : 26
| |
| − | Number of spacers : 1
| |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_11
| |
| − | START crispr position : 2293949
| |
| − | END crispr position : 2294199
| |
| − | Crispr length : 250
| |
| − | DR consensus : CGTTCGCAGCAAAACGGGCCGGAAGGGATTTGAACC DR length : 36
| |
| − | Number of spacers : 2
| |