Difference between revisions of "Shamita P"

From GcatWiki
Jump to: navigation, search
(Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum))
 
(26 intermediate revisions by 2 users not shown)
Line 50: Line 50:
 
'''Possible Downstream Targets of CBFs'''
 
'''Possible Downstream Targets of CBFs'''
  
Rather than triggering a new pathway of genes, CBFs modify already existing metabolic and biological pathways in response to cold stress. Depending on the pathway, CBFs can induce or repress gene expression. Because the activity of CBF is extremely variable, I chose to focus on a specific common pathway on phospholipid signaling outlined in the microarray study conducted by [http://www.hort.purdue.edu/hort/research/zhu/articles/2005/leebh.pdf, Byeong-ha Lee et al]. This study discovered that the timing of induction for genes in the pathway was key to the cold acclimation process. In particular, ''IP5PII'' and ''ADTGK1'' were activated early in the cold acclimation process, while genes such as ''IPK2a'' and phospholipase C (PLC) are induced at a later time. The timing suggests that the former two genes are more upstream in the signaling pathway, while the latter two genes are more downstream.  
+
Rather than triggering a new pathway of genes, CBFs modify already existing metabolic and biological pathways in response to cold stress. Depending on the pathway, CBFs can induce or repress gene expression. Because the activity of CBF is extremely variable, I chose to focus on a specific common pathway on phospholipid signaling outlined in the microarray study conducted by [http://www.hort.purdue.edu/hort/research/zhu/articles/2005/leebh.pdf, Byeong-ha Lee et al]. This study discovered that the timing of induction for genes in the pathway was key to the cold acclimation process. In particular, ''IP5PII'' and ''ATDGK1'' were activated early in the cold acclimation process, while genes such as ''IPK2a'' and phospholipase C (PLC) are induced at a later time. The timing suggests that the former two genes are more upstream in the signaling pathway, while the latter two genes are more downstream.  
  
A KEGG Map of the Phosphotidylinositol Signaling Pathway helps us gain a better picture, that the signaling pathway is not exactly straightforward, and involves several feedback loops. The enzymes of interest are circled in red, where 3.1.3.56 is IP5PII, 2.7.1.107 is ADTGK1 and 2.7.1.140 is IPK2a. SSR Analysis was done for IP5PII, ADTGK1, and IPK2a with results shown below. <br>
+
A KEGG Map of the Phosphotidylinositol Signaling Pathway helps us gain a better picture, that the signaling pathway is not exactly straightforward, and involves several feedback loops. The enzymes of interest are circled in red, where 3.1.3.56 is IP5PII, 2.7.1.107 is ATDGK1 and 2.7.1.140 is IPK2a. SSR Analysis was done for IP5PII, ATDGK1, and IPK2a with results shown below. <br>
 
[[Image:KEGGMAP_cropped.jpg|thumb|center|upright=3|]]<br>
 
[[Image:KEGGMAP_cropped.jpg|thumb|center|upright=3|]]<br>
  
Line 59: Line 59:
 
Using the information gleaned from the literature and also from the results gained through the Vaccinium database, I have constructed a tentative signaling pathway in response to cold environments. Though the pathway is likely correct in the general order of genes activated, it likely excludes intermediate reactions particularly between CBF and IP5II activation. In the pathway, genes in blue indicate ones for which primers have been obtained. See caption for explanation of pathway.
 
Using the information gleaned from the literature and also from the results gained through the Vaccinium database, I have constructed a tentative signaling pathway in response to cold environments. Though the pathway is likely correct in the general order of genes activated, it likely excludes intermediate reactions particularly between CBF and IP5II activation. In the pathway, genes in blue indicate ones for which primers have been obtained. See caption for explanation of pathway.
  
[[File:Tentative_pathway_Final.jpg|thumb|center|900px|alt=Map of the world.|'''Tentative Pathway for Cold Activation in ''Vaccinium corymbosum'''''. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include ''IP5PII'' and ''ADTGK1''. IP5PII continues to activate ''IPK2a'' as seen in the KEGG Map Above.]]<br><br>
+
[[File:Tentative_pathway_Final.jpg|thumb|center|900px|alt=Map of the world.|'''Tentative Pathway for Cold Activation in ''Vaccinium corymbosum'''''. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include ''IP5PII'' and ''ATDGK1''. IP5PII continues to activate ''IPK2a'' as seen in the KEGG Map Above.]]<br><br>
  
 
'''Results'''
 
'''Results'''
Line 127: Line 127:
  
  
''[http://www.ncbi.nlm.nih.gov/nuccore/28393495?report=fasta ADTGK1]'' <br>
+
''[http://www.ncbi.nlm.nih.gov/nuccore/28393495?report=fasta ATDGK1]'' <br>
 
3 Primer Matches on Scaffold 00019 (~355,000-360,000) <br>
 
3 Primer Matches on Scaffold 00019 (~355,000-360,000) <br>
  
Line 166: Line 166:
 
'''EST Search of Genes in the Cold Response Pathway'''
 
'''EST Search of Genes in the Cold Response Pathway'''
  
My goal was to find whether any of the genes I had found in the cold response pathway (''ICE1'', ''ADTGK1'', ''SIZ1'', ''CBF1c'') have been captured within Expressed Sequence Tags (ESTs) for blueberry. I accomplished the search in several ways, but often began by using the sequence from the scaffold to which my gene ortholog had matched and searching for the 3' end of the genes on the scaffold. Note that all ESTs below have been found directly from the Vaccinium webpage.<br>
+
My goal was to find whether any of the genes I had found in the cold response pathway (''ICE1'', ''ATDGK1'', ''SIZ1'', ''CBF1c'') have been captured within Expressed Sequence Tags (ESTs) for blueberry. I accomplished the search in several ways, but often began by using the sequence from the scaffold to which my gene ortholog had matched and searching for the 3' end of the genes on the scaffold. Note that all ESTs below have been found directly from the Vaccinium webpage.<br><br>
  
''ICE1''<br>
+
'''SUMMARY'''<br>
 +
'''''ICE1''''':[http://www.ncbi.nlm.nih.gov/nucest/cv091282 CV091282] (E=10^-4), [http://www.ncbi.nlm.nih.gov/nucest/45743601?report=fasta CF811286], [http://www.ncbi.nlm.nih.gov/nucest/45744508?report=fasta CF810912], and [http://www.ncbi.nlm.nih.gov/nucest/51569995?report=fasta CV090656] (E>1.2).<br>
 +
'''''ATDGK1''''':[http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta CV190823] (E<10^-9).<br>
 +
'''''SIZ1''''':[http://www.ncbi.nlm.nih.gov/nucest/45744136?report=fasta CF810540] (E=10^-4), [http://www.ncbi.nlm.nih.gov/nucest/51570383?report=fasta CV091044] (E=10^-26). <br>
 +
'''''CBF1c''''':[http://www.ncbi.nlm.nih.gov/nucest/105630232?report=fasta DW043014] (E=10^-16), [http://www.ncbi.nlm.nih.gov/nucest/105630342?report=fasta DW043054] (E=10^-16)<br><br>
 +
 
 +
'''''ICE1'''''<br>
 
Length: 1,485 bp<br>
 
Length: 1,485 bp<br>
 
Scaffold: 00051
 
Scaffold: 00051
Line 175: Line 181:
 
[[Image:ICE_inducer of CBF.jpg|thumb|center|upright=5|]]<br>
 
[[Image:ICE_inducer of CBF.jpg|thumb|center|upright=5|]]<br>
  
Additionally, I decided to search a 2,233 bp fragment of the scaffold in which suspected regions of the ICE1 gene were enveloped by PCR primers from the SSR search conducted above. Searching the non-specific nucleotide collection using BLASTn for somewhat similiar sequences, I found that the fragment had excellent matches to ICE sequences in other species including grape (E=10^(-62)). I then used this same fragment in a search for ESTs in the Vaccinium database, finding results with poor E scores (E>1.2): '''CF811286''', '''CF810912''', and '''CV090656'''.<br>
+
Additionally, I decided to search a 2,233 bp fragment of the scaffold in which suspected regions of the ICE1 gene were enveloped by PCR primers from the SSR search conducted above. Searching the non-specific nucleotide collection using BLASTn for somewhat similiar sequences, I found that the fragment had excellent matches to ICE sequences in other species including grape (E=10^(-62)). I then used this same fragment in a search for ESTs in the Vaccinium database, finding results with poor E scores (E>1.2): [http://www.ncbi.nlm.nih.gov/nucest/45743601?report=fasta '''CF811286'''], [http://www.ncbi.nlm.nih.gov/nucest/45744508?report=fasta '''CF810912'''], and [http://www.ncbi.nlm.nih.gov/nucest/51569995?report=fasta '''CV090656'''].<br><br>
  
''ADTGK1''<br>
+
'''''ATDGK1'''''<br>
 
Length: 2,914bp<br>
 
Length: 2,914bp<br>
 
Scaffold: 00019
 
Scaffold: 00019
  
I searched towards the 3' ends of the genes and matched to regions of the scaffold. All three regions searched (between 2,474-2,597 bp, corresponding to 361,728-361,851 on the scaffold) gave the same EST match of [http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta '''CV190823''']. I used the EST to search for its function in BLASTn as I did above, and found that it matched closely to a DAGK gene in grape (E=10^-4).  
+
I searched towards the 3' ends of the genes and matched to regions of the scaffold. All three regions searched (between 2,474-2,597 bp, corresponding to 361,728-361,851 on the scaffold) gave the same EST match of [http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta '''CV190823'''] with the greatest E score being 10^-9. I used the EST to search for its function in BLASTn as I did above, and found that it matched closely to a DAGK gene in grape (E=10^-4). This EST comes from the '''bud library''' which is in the [http://bioinformatics.towson.edu/BBGD454/ Towson database].
 +
 
 +
[[Image:ATDGK1_BLASTimage.jpg|thumb|center|upright=6|]]<br><br>
  
''SIZ1''<br>
+
'''''SIZ1'''''<br>
 
Length: 3,336bp<br>
 
Length: 3,336bp<br>
 
Scaffold: 00717
 
Scaffold: 00717
Line 189: Line 197:
 
Of all the genes I searched, ''SIZ1'' was the most difficult to find EST matches. I began by attempting to search scaffold matches with the 3' ends of genes, which yielded no results at all. Then, I searched a portion of the fragment enveloped by PCR primers from the SSR search. I obtained [http://www.ncbi.nlm.nih.gov/nucest/45744136?report=fasta '''CF810540'''] (E=10^-4) as a viable hit. After inputting only the EST into BLASTn search, I found that the Rhododendron RPC1 gene was the best hit. However, I also input the original scaffold fragment (used to obtain the EST) into NCBI and found that it gave SIZ1 gene in grape as a good match (E=10^-26).  
 
Of all the genes I searched, ''SIZ1'' was the most difficult to find EST matches. I began by attempting to search scaffold matches with the 3' ends of genes, which yielded no results at all. Then, I searched a portion of the fragment enveloped by PCR primers from the SSR search. I obtained [http://www.ncbi.nlm.nih.gov/nucest/45744136?report=fasta '''CF810540'''] (E=10^-4) as a viable hit. After inputting only the EST into BLASTn search, I found that the Rhododendron RPC1 gene was the best hit. However, I also input the original scaffold fragment (used to obtain the EST) into NCBI and found that it gave SIZ1 gene in grape as a good match (E=10^-26).  
  
Additionally, I found a different region of the scaffold that I submitted for EST matching. When I input the result [http://www.ncbi.nlm.nih.gov/nucest/51570383?report=fasta '''CV091044'''] (E=10^-26) into the NCBI database, I found that it matched closely to an ''slf-s5'' gene in F-box (E=10^-6).
+
[[File:SIZ1_ScaffoldSearch.jpg|thumb|center|900px|alt=Map of the world.|'''Tentative Pathway for Cold Activation in ''Vaccinium corymbosum'''''. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include ''IP5PII'' and ''ATDGK1''. IP5PII continues to activate ''IPK2a'' as seen in the KEGG Map Above.]]<br><br>
 +
 
 +
Additionally, I found a different region of the scaffold that I submitted for EST matching. When I input the result [http://www.ncbi.nlm.nih.gov/nucest/51570383?report=fasta '''CV091044'''] (E=10^-26) into the NCBI database, I found that it matched closely to an ''slf-s5'' gene in F-box (E=10^-6).<br>
  
''CBF1c''<br>
+
'''''CBF1c'''''<br>
 
Length: 1,146bp<br>
 
Length: 1,146bp<br>
 
Scaffold: 00009
 
Scaffold: 00009
  
 
The closest match with the 3' end of the gene had occurred at 656bp on the ortholog (487,781bp on the scaffold). I input the small string of characters into the EST search and obtained two very good hits: [http://www.ncbi.nlm.nih.gov/nucest/105630232?report=fasta '''DW043014'''] (E=10^-16) and [http://www.ncbi.nlm.nih.gov/nucest/105630342?report=fasta '''DW043054'''] (E=10^-16). DW043014 was found in the Vaccinium database as having transcription factor activity while DW043054 did not have a description; however, a BLASTn search of both EST sequences in the NCBI database found both to have perfect matches to CBF transcription factors in blueberry (E=0). Thus, these genes have been captured and noted within ESTs.
 
The closest match with the 3' end of the gene had occurred at 656bp on the ortholog (487,781bp on the scaffold). I input the small string of characters into the EST search and obtained two very good hits: [http://www.ncbi.nlm.nih.gov/nucest/105630232?report=fasta '''DW043014'''] (E=10^-16) and [http://www.ncbi.nlm.nih.gov/nucest/105630342?report=fasta '''DW043054'''] (E=10^-16). DW043014 was found in the Vaccinium database as having transcription factor activity while DW043054 did not have a description; however, a BLASTn search of both EST sequences in the NCBI database found both to have perfect matches to CBF transcription factors in blueberry (E=0). Thus, these genes have been captured and noted within ESTs.
 +
 +
[[Image:CBF_BLAST.jpg|thumb|center|upright=6|]]<br>
 +
 +
'''New Scaffolds found with ESTs'''
 +
 +
I used the best EST hit for all genes to find more scaffold matches. Here's what I found:
 +
 +
''ICE1'' CV091282<br>
 +
scaffold00197<br>
 +
length=247576<br>
 +
E score = 0.0<br><br>
 +
scaffold01278<br>
 +
length=69683<br>
 +
E score = 2e-17<br><br>
 +
scaffold01345<br>
 +
length=87746 <br>
 +
E score = 2e-14<br><br><br>
 +
 +
''CBF1c'' DW043014<br>
 +
scaffold00009<br>
 +
length=735401<br>
 +
E score = 0.0<br><br>
 +
scaffold01137 <br>
 +
length=103431 <br>
 +
E score = 2e-10<br><br>
 +
scaffold00814<br>
 +
length=115091  <br>
 +
E score = 4e-05 <br>
 +
Original scaffold used
 +
 +
---
 +
 +
I discovered the Bioinformatics Towson database with the help of Dr. Rowland, and found that it contained a host of EST sequences taken from different tissues of the the blueberry plant under different environmental conditions.
 +
 +
Using the BLAST tool to search portions of the scaffolds for the corresponding genes, I was able to find some ESTs that were good matches. I conducted a non-specific nucleotide search for these ESTs in general BLAST to find their functions. If I was satisfied with the functions I saw, I used the ESTs to find new scaffold matches for the genes.
 +
 +
 +
'''''SIZ1'''''
 +
 +
Portion of the SIZ1 scaffold (pg 34) was insterted in BLASTn against All 454 Sequences.
 +
Best result obtained was F5QOTHQ01DH7A0 (E=10^-112). Then, I downloaded all sequences (available as a zip file) and opened each of the three fna files until I found this sequences (no description available).
 +
 +
 +
F5QOTHQ01DH7A0 length=381
 +
ATCAGACACGTCTAGAGGCCGAGGCGGCCGACATGTTTTGTCTTTTGTTCTGTTTCTTTTTTTTTCGACAAGAAACTCTTCATTAAAATTACTCTAAGTCTTTACAAAGAACAACTTCAAAACCGGGCGGAATACAACCCGTATTAAGCAAAAAGGAACTATCAAGACATTTAGAAGCTAACCAATGTGCGGCTTTGTTTTTCTCTCTACAACACCAAACAAAAGACCAGTTGCTAGAAGTTGCCCAATACTTGATGTCTTCTACCAGAGCTCGAATCTCCCAAGGACCTGTAGAATTTACCGATTGAAGGCAAGTGATGAGTTCCAAGCAGTCAGATTCAAACACTACCTCTGAGAACTTCATCTGCCTTGCGACATCAC
 +
 +
I input this sequence into the nonspecific nucleotide BLASTn search of NCBI and found that there were several good matches to the general pathway that SIZ1 is involved in ie) cellular stresses associated with cold tolerance (and drought). The movement of water is similar under stresses of cold and drought.
 +
 +
[[Image:SIZ1_Towson.jpg|thumb|center|upright=6|]]<br>
 +
 +
'''Scaffolds Found using the EST(4 New)''' <br>
 +
scaffold02191  length=47427  e-146 *NEW<br>
 +
scaffold00717  length=144267  e-112 <br>
 +
scaffold00530  length=187309  1e-66 *NEW<br>
 +
scaffold00751  length=152548  9e-52 *NEW<br>
 +
scaffold04605  length=6686    6e-16 *NEW<br><br>
 +
 +
 +
'''''ICE1'''''
 +
 +
Same method to obtain EST as above was used for this gene. The best hit obtained for a portion of the scaffold 00051 was a contig08655.
 +
[[Image:ICE1_Towson.jpg|thumb|center|upright=6|]]<br>
 +
 +
EST (F5BH0J002JLUPG) was another good hit from a different portion of the scaffold whose sequence I was able to locate, and search in NCBI, finding that it was a good match for another populus EST in drought stressed leaves.
 +
 +
Using the EST sequences, I found new scaffolds.
 +
 +
'''Scaffolds Found using the EST(All New)''' <br>
 +
scaffold00508  length=174034    0.0 <br> 
 +
scaffold00628  length=181951    3e-55 <br>
 +
scaffold00440  length=239660    3e-55 <br>
 +
scaffold01645  length=53899      4e-45 <br>
 +
scaffold00936  length=116958    9e-43 <br>
 +
scaffold02480  length=50312      2e-40 <br>
 +
 +
'''''ATDGK1'''''
 +
 +
Dr. Campbell is helping me find EST matches for this gene using the Towson database. He began with the EST I had found as a good match on the Vaccinium webpage [http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta '''CV190823''']. Using this EST, he searched the all 454 sequences in the Towson website, and found a sufficient match to a contig09083. The name of this exact contig was found in a the results of Bud tissues, but it appears that the names are not unique identifiers because the actual sequences are different. The Bud contig was BLASTED against NR Genbank, which found the best match as a phosphoinositol phosophatase in grape.
 +
 +
Taking a portion of the original contig hit from Towson, he searched NR Genbank. The best EST match found was the same I found above, confirming my results.
 +
 +
Dr. C then used this EST to find possible new scaffold maches in the Vaccinium database. Of the two best hits, one confirmed my previous 00019, and the other was a new hit.
 +
 +
'''Scaffolds Found using the EST(One New)''' <br>
 +
scaffold00019  length=528048    0.0 <br> 
 +
scaffold00393  length=244216    1e-21 <br>

Latest revision as of 18:12, 17 April 2012

Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

General background on cold tolerance

Winter Acclimation and Cold Hardiness of the Blueberry: Primarily geared towards individuals who wish to cultivate blueberries, but provides some good general background information on the cold tolerance associated with regional varieties.

Additionally, Polashock et al (2010) provides substantial background information on genetic basis of cold tolerance. In summary, they discuss that the purpose behind studying these genes is to understand how modifying cold-tolerance in blueberry might prevent massive crop loss due to freezing temperatures during a winter frost. The overall acclimation to cold occurs in two steps, the first of which is induced by a shorter photo-period (less sunlight), and the second of which is induced by lower temperatures. Polashock et al targeted a host of genes in a family of transcription factors called CBF (C-repeat binding factor). These TF appear to bind a conserved region CCGAC within promoters that activate a host of downstream genes involved in cold acclimation. Using this gene as a starting point, I decided to search for candidate genes downstream of CBFs in other species that were being activated in cold conditions.


Searching the CBF (C-repeat binding factor) genes

The exciting thing about CBFs is that they are found in many species of plants. So, if there are genes downstream of this TF in those plant species, they might be good targets for study in blueberry as well. I explored various papers discussing cold tolerance genes in Eucalyptus, Arabidopsis, and common wheat. Although common wheat is a monocot, I felt like it would be worth exploring because like blueberry, it is an important crop and might also have invested interest in its frost tolerance.

Starting with the paper above by Polashock et al, I obtained a list of the following genes from the following papers:

Cold Acclimation/Freezing Tolerance in Blueberries
Polashock et al (2010)
-COR6.6
-COR78
-COR15A etc..

Frost Tolerance in Temperate Cereals
Galiba et al (2009)
-FR2
-TaCBF14
-TaCBF15

Cold Tolerance in Eucalyptus Species
Navarro et al (2009)
-EguCBF1c
-EguCBF1d

Cold Tolerance signaling in Arabidopsis: ICE (Induction of CBF Expression)
Lissarre et al, 2010
-ICE1
-ICE2

CBF Genes

I decided to study at least one of the CBF transcription activators not found in blueberry as well as one frost tolerance gene found to be downstream of CBF. I searched the NCBI database to obtain mRNA sequences of my genes of interest. Of the several genes that I input into the Vaccinium database (conducting tBLASTx against the scaffolds), I found that there were two genes in particular with promising results. The first of these was the EguCBF1c in Eucalyptus, whose match against Scaffold 00009 had an E score of 10^(-31). When I submitted TaCBF14 gene from common wheat for analysis in the same manner, the top hit was also Scaffold 00009 with an E score of 10^(-17).

The tBLASTx translated my mRNA query into a protein and then matched it with all proteins constructed by all reading frames of the nucleotide sequence of the scaffolds. For this reasons, it's the longest search conducted in the BLAST database. Using the amino acid sequences that were output and their corresponding nucleotide matches to the scaffold, I was able to approximate where in the scaffold my genes were located. Both CBF genes Eucalyptus and Common wheat produced hits in the same region of the scaffold, at approximately 488,000 bp.

I submitted scaffold 00009 to be searched for SSRs using default parameters that favored lengthy di- or tri- nucleotide repeats. Vaccinium.org returns an excel file with the location and length of SSRs along with primers engineered to amplify the regions containing the SSR. See below.

Error creating thumbnail: Unable to save thumbnail to destination

Choosing SSRs in the vicinity of my genes, I found 4 lengthy di-nucleotide repeats and one tri-nucleotide repeat around 488,000 bp (not pictured). The excel file does not always contain primers for every SSR match, so those positions are of no use to us. For primers it does provide, I chose ones that produced PCR products that were less than 300 bp.

When mapping this to the 282 pg Word File which contained the entire scaffold 00009, I found my SSR matches to be about 4 pages away from the 11 combined hits found from the gene search on the scaffold.

ICE1 Gene

Beginning with the tBLASTx search, I used the same steps with the ICE1 gene in Arabidopsis. The scaffold first hit on my search was Scaffold 00051 with an E score of 10^(-80). This is an extremely strong hit, that had 19 fragments of the ICE1 gene matching to the blueberry scaffold in high precision. All matches were between 55,000 and 60,000 bp on the scaffold. I submitted Scaffold 00051 to the SSR database and found primers for two di-nucleotide and one tri-nucleotide repeats. Two of the primers were within the 5,000 bp range, while one was found at 67,000 bp.

SIZ1 Gene

Upon further reading (Lissarre et al, 2010), I found that ICE1 is activated by SIZ1 mediated SUMOylation. SUMOylation is a type of post-translational modification that involves the addition of a Small Ubiquitin-like Modifier (SUMO) to a protein, causing that protein to change its structure and thus its function 1. Among many reasons, SUMOylation is instigated in environments of stress such as freezing temperatures. I obtained the SIZ1 mRNA sequence for Arabidopsis and performed a tBLASTx on the sequence in the Vaccinium database. I found an exceptional match to scaffold 00717 (E = 0.0) and devised primers for this scaffold in the vicinity of the gene (85,000-107,000 bp). I found three good matches, whose PCR lengths and primers are shown below.

Possible Downstream Targets of CBFs

Rather than triggering a new pathway of genes, CBFs modify already existing metabolic and biological pathways in response to cold stress. Depending on the pathway, CBFs can induce or repress gene expression. Because the activity of CBF is extremely variable, I chose to focus on a specific common pathway on phospholipid signaling outlined in the microarray study conducted by Byeong-ha Lee et al. This study discovered that the timing of induction for genes in the pathway was key to the cold acclimation process. In particular, IP5PII and ATDGK1 were activated early in the cold acclimation process, while genes such as IPK2a and phospholipase C (PLC) are induced at a later time. The timing suggests that the former two genes are more upstream in the signaling pathway, while the latter two genes are more downstream.

A KEGG Map of the Phosphotidylinositol Signaling Pathway helps us gain a better picture, that the signaling pathway is not exactly straightforward, and involves several feedback loops. The enzymes of interest are circled in red, where 3.1.3.56 is IP5PII, 2.7.1.107 is ATDGK1 and 2.7.1.140 is IPK2a. SSR Analysis was done for IP5PII, ATDGK1, and IPK2a with results shown below.

KEGGMAP cropped.jpg

Tentative Cold Response Pathway in Blueberry

Using the information gleaned from the literature and also from the results gained through the Vaccinium database, I have constructed a tentative signaling pathway in response to cold environments. Though the pathway is likely correct in the general order of genes activated, it likely excludes intermediate reactions particularly between CBF and IP5II activation. In the pathway, genes in blue indicate ones for which primers have been obtained. See caption for explanation of pathway.

Map of the world.
Tentative Pathway for Cold Activation in Vaccinium corymbosum. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include IP5PII and ATDGK1. IP5PII continues to activate IPK2a as seen in the KEGG Map Above.


Results

EguCBF1c and TaCBF14
3 Primer Matches on Scaffold 00009 (~488,000 bp)

Forward Primer: AGTTCTAAACCGATTGTGCGTT 
Reverse Primer: AATTCCAACCTAACTGCCAGAA 
TG 10x @ 479,956 bp, Product: 291 bp

Forward Primer: TCTCTCTCAGATCTCTGATCCGT
Reverse Primer: AAAGCAAGAAGAGAAATGGTGG
TCT 5x @ 479,466 bp, Product: 110 bp

Forward Primer: AATCTGCAAATCTCCATCACCT
Reverse Primer: TCCTAAAAACCAAAGCATGTCC
CT 11x @ 463,925 bp, Product: 226 bp


ICE1
3 Primer Matches on Scaffold 00051 (~55,000 - 60,000 bp)

Forward Primer: CGCATCTTTACTCCACTAACCC
Reverse Primer: AATCCCTGCTGTGTATCTTGGT
TC 5x @ 55,088 bp, Product: 127 bp

Forward Primer: GTGGGGAGCAAACTCACTAATC
Reverse Primer: AATAACAAAAACTCGCTCTCGC
CA 5x @ 67,058 bp, Product: 186 bp

Forward Primer: GAGAAGTGAAGGAATGGAGGTG
Reverse Primer: CGAAATGGGTTCACTCTCTACC
TGT 4x @ 60,104 bp, Product: 259 bp


SIZ1
3 Primer Matches on Scaffold 00717 (~85,000 - 107,000 bp)

Forward Primer: AAGCCGCATATTAGAGCGTATC
Reverse Primer: CCTCCCTCCTCTCTCTCTCTCT
AG 21x @ 86,562 bp, Product: 300 bp

Forward Primer: ATTGCAATCTTGCACAGAGAGA
Reverse Primer: CTACATAGGATACGCATTGGCA
AG 13x @ 86,761 bp, Product: 279 bp

Forward Primer: CATTTGTACCCCCTCAAGTAGC
Reverse Primer: TTTCCCTAGTGGTGAAGTGTGA
GA 6x @ 107,162 bp, Product: 157 bp


IP5PII
3 Primer Matches on Scaffold 00661 (~93,000-105,000)

Forward Primer: GATTCGAACGGCAGTATAAACC
Reverse Primer: GCCCTTATCAATCTCCAAATGA
AT 6x @ 106,789, Product: 222 bp

Forward Primer: ATGGAGTACCAAGGAAAAACGA
Reverse Primer: CCATTTTTATCGGGGTGAGTAA
TC 13x @ 81,787, Product: 246 bp

Forward Primer: TCTCTTCTACTGTCAGAGGCCC
Reverse Primer: CACTCTGTTTGGAAAATGTGGA
ATA 5x @ 86,548, Product: 231 bp


ATDGK1
3 Primer Matches on Scaffold 00019 (~355,000-360,000)

Forward Primer: CTAGCCTACCAACTACCTCCGA
Reverse Primer: GGATTGCTTCTCTGTTTCTGCT
AG 7x @ 352,411, Product: 214 bp

Forward Primer: AGCAGAAACAGAGAAGCAATCC
Reverse Primer: CAAGGCAAACCCTAGAGAGAGA
CT 11x @ 352,582, Product: 143 bp

Forward Primer: TTGAACATGCTCTTGAATCCTG
Reverse Primer: TACGTGAGTATCATCCACAGCC
AATA 4x @ 355,495, Product: 131 bp


IPK2a
4 Primer Matches on Scaffold 00135 (~2,000-3,000)

Forward Primer: AATCAATCAGTTGACATGCGTC
Reverse Primer: GCTTAAAGCTTAACAAGCCCAA
CT 5x @ 7,764, Product: 197 bp

Forward Primer: ATCTAAATGTTTAATCGGGGGC
Reverse Primer: ATCTAGGGAGACTGTTGGGGAT
TG 6x @ 17,950, Product: 143 bp

Forward Primer: CCAATGCTGCTTCACTGTACTC
Reverse Primer: TACTTGTCGGTTGCAGATTCAC
AAAC 3x @ 7,124, Product: 229 bp

Forward Primer: ACCCATCCGAGGTATGTTACAG
Reverse Primer: AAAGATTAAAGGCGGATAAGGC
TTCGG 3x @ 791, Product: 108 bp

Click Media:Blueberry Cold Response Pathway.pptx for PowerPoint containing all information on this Wiki Page.

EST Search of Genes in the Cold Response Pathway

My goal was to find whether any of the genes I had found in the cold response pathway (ICE1, ATDGK1, SIZ1, CBF1c) have been captured within Expressed Sequence Tags (ESTs) for blueberry. I accomplished the search in several ways, but often began by using the sequence from the scaffold to which my gene ortholog had matched and searching for the 3' end of the genes on the scaffold. Note that all ESTs below have been found directly from the Vaccinium webpage.

SUMMARY
ICE1:CV091282 (E=10^-4), CF811286, CF810912, and CV090656 (E>1.2).
ATDGK1:CV190823 (E<10^-9).
SIZ1:CF810540 (E=10^-4), CV091044 (E=10^-26).
CBF1c:DW043014 (E=10^-16), DW043054 (E=10^-16)

ICE1
Length: 1,485 bp
Scaffold: 00051

I found that position 1,003 bp of the gene ortholog matched to position 57,896 bp in the scaffold and used the small string of bases to input into the EST database. The best EST match located was CV091282 with an E=10^-4. When I searched this small string in NCBI, I found that it was a good match to a gene of CBF expression in another species (E=10^-9).

Error creating thumbnail: Unable to save thumbnail to destination

Additionally, I decided to search a 2,233 bp fragment of the scaffold in which suspected regions of the ICE1 gene were enveloped by PCR primers from the SSR search conducted above. Searching the non-specific nucleotide collection using BLASTn for somewhat similiar sequences, I found that the fragment had excellent matches to ICE sequences in other species including grape (E=10^(-62)). I then used this same fragment in a search for ESTs in the Vaccinium database, finding results with poor E scores (E>1.2): CF811286, CF810912, and CV090656.

ATDGK1
Length: 2,914bp
Scaffold: 00019

I searched towards the 3' ends of the genes and matched to regions of the scaffold. All three regions searched (between 2,474-2,597 bp, corresponding to 361,728-361,851 on the scaffold) gave the same EST match of CV190823 with the greatest E score being 10^-9. I used the EST to search for its function in BLASTn as I did above, and found that it matched closely to a DAGK gene in grape (E=10^-4). This EST comes from the bud library which is in the Towson database.

Error creating thumbnail: Unable to save thumbnail to destination


SIZ1
Length: 3,336bp
Scaffold: 00717

Of all the genes I searched, SIZ1 was the most difficult to find EST matches. I began by attempting to search scaffold matches with the 3' ends of genes, which yielded no results at all. Then, I searched a portion of the fragment enveloped by PCR primers from the SSR search. I obtained CF810540 (E=10^-4) as a viable hit. After inputting only the EST into BLASTn search, I found that the Rhododendron RPC1 gene was the best hit. However, I also input the original scaffold fragment (used to obtain the EST) into NCBI and found that it gave SIZ1 gene in grape as a good match (E=10^-26).

Error creating thumbnail: Unable to save thumbnail to destination
Tentative Pathway for Cold Activation in Vaccinium corymbosum. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include IP5PII and ATDGK1. IP5PII continues to activate IPK2a as seen in the KEGG Map Above.


Additionally, I found a different region of the scaffold that I submitted for EST matching. When I input the result CV091044 (E=10^-26) into the NCBI database, I found that it matched closely to an slf-s5 gene in F-box (E=10^-6).

CBF1c
Length: 1,146bp
Scaffold: 00009

The closest match with the 3' end of the gene had occurred at 656bp on the ortholog (487,781bp on the scaffold). I input the small string of characters into the EST search and obtained two very good hits: DW043014 (E=10^-16) and DW043054 (E=10^-16). DW043014 was found in the Vaccinium database as having transcription factor activity while DW043054 did not have a description; however, a BLASTn search of both EST sequences in the NCBI database found both to have perfect matches to CBF transcription factors in blueberry (E=0). Thus, these genes have been captured and noted within ESTs.

Error creating thumbnail: Unable to save thumbnail to destination

New Scaffolds found with ESTs

I used the best EST hit for all genes to find more scaffold matches. Here's what I found:

ICE1 CV091282
scaffold00197
length=247576
E score = 0.0

scaffold01278
length=69683
E score = 2e-17

scaffold01345
length=87746
E score = 2e-14


CBF1c DW043014
scaffold00009
length=735401
E score = 0.0

scaffold01137
length=103431
E score = 2e-10

scaffold00814
length=115091
E score = 4e-05
Original scaffold used

---

I discovered the Bioinformatics Towson database with the help of Dr. Rowland, and found that it contained a host of EST sequences taken from different tissues of the the blueberry plant under different environmental conditions.

Using the BLAST tool to search portions of the scaffolds for the corresponding genes, I was able to find some ESTs that were good matches. I conducted a non-specific nucleotide search for these ESTs in general BLAST to find their functions. If I was satisfied with the functions I saw, I used the ESTs to find new scaffold matches for the genes.


SIZ1

Portion of the SIZ1 scaffold (pg 34) was insterted in BLASTn against All 454 Sequences. Best result obtained was F5QOTHQ01DH7A0 (E=10^-112). Then, I downloaded all sequences (available as a zip file) and opened each of the three fna files until I found this sequences (no description available).


F5QOTHQ01DH7A0 length=381 ATCAGACACGTCTAGAGGCCGAGGCGGCCGACATGTTTTGTCTTTTGTTCTGTTTCTTTTTTTTTCGACAAGAAACTCTTCATTAAAATTACTCTAAGTCTTTACAAAGAACAACTTCAAAACCGGGCGGAATACAACCCGTATTAAGCAAAAAGGAACTATCAAGACATTTAGAAGCTAACCAATGTGCGGCTTTGTTTTTCTCTCTACAACACCAAACAAAAGACCAGTTGCTAGAAGTTGCCCAATACTTGATGTCTTCTACCAGAGCTCGAATCTCCCAAGGACCTGTAGAATTTACCGATTGAAGGCAAGTGATGAGTTCCAAGCAGTCAGATTCAAACACTACCTCTGAGAACTTCATCTGCCTTGCGACATCAC

I input this sequence into the nonspecific nucleotide BLASTn search of NCBI and found that there were several good matches to the general pathway that SIZ1 is involved in ie) cellular stresses associated with cold tolerance (and drought). The movement of water is similar under stresses of cold and drought.

Error creating thumbnail: Unable to save thumbnail to destination

Scaffolds Found using the EST(4 New)
scaffold02191 length=47427 e-146 *NEW
scaffold00717 length=144267 e-112
scaffold00530 length=187309 1e-66 *NEW
scaffold00751 length=152548 9e-52 *NEW
scaffold04605 length=6686 6e-16 *NEW


ICE1

Same method to obtain EST as above was used for this gene. The best hit obtained for a portion of the scaffold 00051 was a contig08655.

Error creating thumbnail: Unable to save thumbnail to destination

EST (F5BH0J002JLUPG) was another good hit from a different portion of the scaffold whose sequence I was able to locate, and search in NCBI, finding that it was a good match for another populus EST in drought stressed leaves.

Using the EST sequences, I found new scaffolds.

Scaffolds Found using the EST(All New)
scaffold00508 length=174034 0.0
scaffold00628 length=181951 3e-55
scaffold00440 length=239660 3e-55
scaffold01645 length=53899 4e-45
scaffold00936 length=116958 9e-43
scaffold02480 length=50312 2e-40

ATDGK1

Dr. Campbell is helping me find EST matches for this gene using the Towson database. He began with the EST I had found as a good match on the Vaccinium webpage CV190823. Using this EST, he searched the all 454 sequences in the Towson website, and found a sufficient match to a contig09083. The name of this exact contig was found in a the results of Bud tissues, but it appears that the names are not unique identifiers because the actual sequences are different. The Bud contig was BLASTED against NR Genbank, which found the best match as a phosphoinositol phosophatase in grape.

Taking a portion of the original contig hit from Towson, he searched NR Genbank. The best EST match found was the same I found above, confirming my results.

Dr. C then used this EST to find possible new scaffold maches in the Vaccinium database. Of the two best hits, one confirmed my previous 00019, and the other was a new hit.

Scaffolds Found using the EST(One New)
scaffold00019 length=528048 0.0
scaffold00393 length=244216 1e-21