Difference between revisions of "Davidson Projects with Updates"

From GcatWiki
Jump to: navigation, search
(Building XOR Gate)
(Building LasI sender '''TESTER''' cell)
 
(101 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
== Building LuxI sender '''TESTER''' cell ==
 
== Building LuxI sender '''TESTER''' cell ==
R0011 (verified) + F1610 (not right part from registry)<br>
+
<BR>
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2007 registry <br>
 
If we get this and verify, we are done with this. If not, we are in need of LuxI part.<br>
 
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
!width"50"|
+
!width"50"|Part #
 
!width="100"|Colonies from Registry Recovery?
 
!width="100"|Colonies from Registry Recovery?
 
!width="100"|Gel Verification?
 
!width="100"|Gel Verification?
!width="100"|Successful Ligation?
 
 
!width="100"|Status of Testing the Device
 
!width="100"|Status of Testing the Device
 +
!width="100"|Experimental Outcome
 
|-
 
|-
|S03608|| Yes || || Not necessary ||
+
|[http://partsregistry.org/Part:BBa_S03608 S03608]|| Yes || Yes || Ready || Successful
 
|-
 
|-
|}
+
|}<br>
 +
[[Image:S03608.jpg]]<br>
 +
<br>
  
 
== Building LuxR receiver '''TESTER''' cell ==
 
== Building LuxR receiver '''TESTER''' cell ==
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. <br>
+
<br>
 
 
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
 
!width"50"|
 
!width"50"|
 
!width="100"|Colonies from Registry Recovery?
 
!width="100"|Colonies from Registry Recovery?
 
!width="100"|Gel Verification?
 
!width="100"|Gel Verification?
!width="100"|Successful Ligation?
 
 
!width="100"|Status of Testing the Device
 
!width="100"|Status of Testing the Device
 +
!width="100"|Experimental Outcome
 
|-
 
|-
|K09100|| Yes || Yes || Not necessary||
+
|[http://partsregistry.org/Part:BBa_K09100 K09100]|| Yes || Yes || Ready || Successful
 
|-
 
|-
|} <br>
+
|}<br>
Ready to test.
+
[[Image:K09100.jpg]]<br>
 +
<br>
  
== Building LuxS sender '''TESTER''' cell ==
+
== '''TESTING''' Lux Sender & Receiver Cells ==
 +
<BR>
 +
[[Image:setup1.jpg]]
 +
<br><br><br><br>
 +
[[Image:official.jpg]]
 +
<br><br>
  
Parts to be built <br>
+
== Building LuxR constitutive protein ==
LacIpL (R0011) + RBS (B0034) + LuxS + TT
+
[http://partsregistry.org/Part:BBa_J23100 J23100] + [http://partsregistry.org/wiki/index.php?title=Part:BBa_J37033 J37033]
  
LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxI tester system.
+
{| border="1" cellpadding="2"
 
+
!width"50"|
== Building LsrK/LsrR receiver '''TESTER''' cell ==
+
!width="100"|Colonies from Registry Recovery?
LsrKp + RBS + LsrK + TT
+
!width="100"|Gel Verification?
 
+
!width="100"|Status of Testing the Device
LsrRp + RBS + LsrR + reporter (GFP/RFP/YFP) + TT
+
!width="100"|Experimental Outcome
 
+
|-
LsrK needs to be constitutively expressed in order to receive the AI-2 signal. LsrR acts as its own repressor, so the reporter should not be activated until the AI-2 signal is received. Once LsrR binds to AI-2 molecule, the LsrR gene is activated and the positive feedback loop is initiated, which also turns on the reporter gene.
+
|[http://partsregistry.org/Part:BBa_J23100 J23100]|| Yes || ? || ? || ?
 +
|-
 +
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_J37033 J37033]|| Yes || ? || ? || ?
 +
|}<br>
 +
[[Image:promoter.jpg]] + [[Image:coding.jpg]]
  
 
== Building LasI sender '''TESTER''' cell ==
 
== Building LasI sender '''TESTER''' cell ==
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].
+
[http://partsregistry.org/Part:BBa_R0011 R0011] + [http://partsregistry.org/Part:BBa_B0034 B0034] +  [http://partsregistry.org/Part:BBa_C0078 C0178].<br>
 +
[[Image:InsertHere.jpg]]
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
 
!width="50"|
 
!width="50"|
Line 52: Line 62:
 
!width="100"|Status of Testing the Device
 
!width="100"|Status of Testing the Device
 
|-
 
|-
|R0011|| Yes || Yes || ||
+
|[http://partsregistry.org/Part:BBa_R0011 R0011]|| Yes || Yes || ||
 +
|-
 +
|[http://partsregistry.org/Part:BBa_B0034 B0034]|| Yes|| Yes ||  ||
 
|-
 
|-
|S03154 || Yes|| Yes ||  ||
+
|[http://partsregistry.org/Part:BBa_C0178 C0178]|| Yes|| Yes ||  ||
 
|}
 
|}
 +
<br>
 +
[[Image:las.jpg]]
 +
<br>
  
 
== Building LasR receiver '''TESTER''' cell ==
 
== Building LasR receiver '''TESTER''' cell ==
Ligatiion 1A S03156 + B0015 <br>
+
{| border="1" cellpadding="2"
 +
!width="50"|
 +
!width="100"|Colonies from Registry Recovery?
 +
!width="100"|Gel Verification?
 +
!width="100"|Successful Ligation?
 +
!width="100"|Status of Testing the Device
 +
|-
 +
|S03156|| Yes || Yes || Yes ||
 +
|-
 +
|B0015|| Yes|| Yes|| Yes ||
 +
|-
 +
|R0079|| Yes || Yes || Yes ||
 +
|-
 +
|E0240|| Yes || Yes || Yes ||
 +
|-
 +
|S03954|| N/A || Yes || Yes ||
 +
|-
 +
|S03955|| N/A || Yes || Yes ||
 +
|-
 +
|S03956|| N/A || Yes || Yes ||
 +
|-
 +
|S03966|| N/A || Yes || Yes ||
 +
|-
 +
|K091134|| N/A || Yes || Yes || Ready ||
 +
|-
 +
|}
 +
<br>
 +
 
 +
Ligation 1A S03156 + B0015 <br>
 
Ligation 1B R0079 + E0240<br>
 
Ligation 1B R0079 + E0240<br>
 
Ligation 1C B0015 + R0079<br>
 
Ligation 1C B0015 + R0079<br>
 +
Done!<br>
 +
A ([http://partsregistry.org/Part:BBa_S03954 S03954])
 +
[[Image:S03954.jpg]]<br>
 +
B ([http://partsregistry.org/Part:BBa_S03956 S03956])
 +
[[Image:S03956.jpg]]<br>
 +
C([http://partsregistry.org/Part:BBa_S03955 S03955])
 +
[[Image:C_1.jpg]]
 +
<br>
 +
<br>
 +
Ligation 2: pLacI ([http://partsregistry.org/Part:BBa_R0011 R0011]) + Successful Ligation 1A ([http://partsregistry.org/Part:BBa_S03954 S03954])<br>
 +
Done! ('''in pSB1AK3''')<br>
 +
[[Image:pLacI.jpg]] + [[Image:S03954.jpg]]<br>
 +
<br>
 +
Ligation 3: Successful Ligation 2 ([http://partsregistry.org/Part:BBa_S03966 S03966])+ [http://partsregistry.org/Part:BBa_S03956 S03956]<br>
 +
[[Image:pLacI.jpg]][[Image:S03954.jpg]] + [[Image:S03956.jpg]]<br>
 +
Done!<br>
 +
([http://partsregistry.org/Part:BBa_K091134 K091134])<br>
 +
[[Image:K091134.jpg]]
 
<br>
 
<br>
Ligation 2: Successful Ligation 1A + Successful Ligation 1B<br>
+
 
Ligation 3: Successful Ligation 2 + R0011<br>
+
== Building LasR constitutive protein ==
 +
[http://partsregistry.org/Part:BBa_J23100 J23100] + [http://partsregistry.org/Part:BBa_S03954 S03954]
  
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
!width="50"|
+
!width"50"|
 
!width="100"|Colonies from Registry Recovery?
 
!width="100"|Colonies from Registry Recovery?
 
!width="100"|Gel Verification?
 
!width="100"|Gel Verification?
!width="100"|Successful Ligation?
 
 
!width="100"|Status of Testing the Device
 
!width="100"|Status of Testing the Device
 +
!width="100"|Experimental Outcome
 
|-
 
|-
|S03156|| Yes || Yes || ||
+
|[http://partsregistry.org/Part:BBa_J23100 J23100]|| Yes || Yes || ? || ?
 
|-
 
|-
|B0015|| Yes|| Yes|| ||
+
|[http://partsregistry.org/Part:BBa_S03954 S03954]|| Yes || Yes || Ready || Pending
 
|-
 
|-
|R0079|| Yes|| Yes || ||
+
|}<br>
 +
[[Image:J23100.jpg]] + [[Image:S03954.jpg]]
 +
 
 +
== Building LsrK/LsrR receiver '''TESTER''' cell ==
 +
LsrKp + RBS + LsrK + TT
 +
 
 +
LsrRp + RBS + LsrR + reporter (GFP/RFP/YFP) + TT
 +
 
 +
LsrK needs to be constitutively expressed in order to receive the AI-2 signal. LsrR acts as its own repressor, so the reporter should not be activated until the AI-2 signal is received. Once LsrR binds to AI-2 molecule, the LsrR gene is activated and the positive feedback loop is initiated, which also turns on the reporter gene.<br>
 +
{| border="1" cellpadding="2"
 +
!width"50"|
 +
!width="100"|Colonies from Registry Recovery?
 +
!width="100"|Gel Verification?
 +
!width="100"|Status of Testing the Device
 +
!width="100"|Experimental Outcome
 
|-
 
|-
|E0240|| Yes|| Yes || ||
+
|part no.|| ? || ? || ? || ?
 
|-
 
|-
|R0011|| Yes|| Yes|| ||
+
|}<br>
|-
 
|}
 
  
 
== Testing Crosstalk between Lux and Las ==
 
== Testing Crosstalk between Lux and Las ==
Line 134: Line 208:
 
We will need to have constitutive LasR and LuxR made in these cells.<br>
 
We will need to have constitutive LasR and LuxR made in these cells.<br>
 
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]
 
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]
 +
  
 
== Making Better pLac promoter and LacI proteins ==
 
== Making Better pLac promoter and LacI proteins ==
Line 211: Line 286:
 
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]
 
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]
 
|-
 
|-
|###|| ### || ###
+
|} <br>
|}
+
'''Testing Lac promoters and proteins''' <br>
 +
''Construct One'' <br>
 +
[[Image:Construct12.jpg]] <br>
 +
''Construct Two'' <br>
 +
[[Image:Construct2.jpg]] <br>
 +
-We will test by ligating each of these constructs together with the 3 different lac promoters and the 4 different Lac proteins. We will measure the output of GFP to characterize the strength of each promoter and protein. We will have 12 constructs all together.

Latest revision as of 00:05, 22 July 2008

Building LuxI sender TESTER cell


Part # Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
S03608 Yes Yes Ready Successful

S03608.jpg

Building LuxR receiver TESTER cell


Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
K09100 Yes Yes Ready Successful

K09100.jpg

TESTING Lux Sender & Receiver Cells


Setup1.jpg



Official.jpg

Building LuxR constitutive protein

J23100 + J37033

Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
J23100 Yes  ?  ?  ?
J37033 Yes  ?  ?  ?

Promoter.jpg + Coding.jpg

Building LasI sender TESTER cell

R0011 + B0034 + C0178.
File:InsertHere.jpg

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
R0011 Yes Yes
B0034 Yes Yes
C0178 Yes Yes


Las.jpg

Building LasR receiver TESTER cell

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
S03156 Yes Yes Yes
B0015 Yes Yes Yes
R0079 Yes Yes Yes
E0240 Yes Yes Yes
S03954 N/A Yes Yes
S03955 N/A Yes Yes
S03956 N/A Yes Yes
S03966 N/A Yes Yes
K091134 N/A Yes Yes Ready


Ligation 1A S03156 + B0015
Ligation 1B R0079 + E0240
Ligation 1C B0015 + R0079
Done!
A (S03954) S03954.jpg
B (S03956) S03956.jpg
C(S03955) C 1.jpg

Ligation 2: pLacI (R0011) + Successful Ligation 1A (S03954)
Done! (in pSB1AK3)
PLacI.jpg + S03954.jpg

Ligation 3: Successful Ligation 2 (S03966)+ S03956
PLacI.jpgS03954.jpg + S03956.jpg
Done!
(K091134)
K091134.jpg

Building LasR constitutive protein

J23100 + S03954

Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
J23100 Yes Yes  ?  ?
S03954 Yes Yes Ready Pending

J23100.jpg + S03954.jpg

Building LsrK/LsrR receiver TESTER cell

LsrKp + RBS + LsrK + TT

LsrRp + RBS + LsrR + reporter (GFP/RFP/YFP) + TT

LsrK needs to be constitutively expressed in order to receive the AI-2 signal. LsrR acts as its own repressor, so the reporter should not be activated until the AI-2 signal is received. Once LsrR binds to AI-2 molecule, the LsrR gene is activated and the positive feedback loop is initiated, which also turns on the reporter gene.

Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
part no.  ?  ?  ?  ?

Testing Crosstalk between Lux and Las

1) Mix LuxI sender cells with LasR receiver tester cells: negative control
2) Mix LasI sender cells with LuxR receiver tester cells: negative control
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green
5) Verify LuxR receiver tester cells don't glow solo
6) Verify LasR receiver tester cells don't glow solo

AND gate using pTetLac promoter

We have successfully built the pTetLac AND promoter: K091101.
This is sequence verified.
Now we need the various LacI proteins (I12, X86 and I12+X86 variants).
We need tetR repressor protein. We have tried to get it from the paper registry.
We need to see if this AND gate works as designed.
We need to test output to see if the two halves are balanced.

Building XOR Gate

List of auto-inducers and their catalog numbers.

Davidson Approach

Here is an idea Malcolm and Laurie developed.

Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.
XOR AMC1b.jpg

The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone (3OC6HSL)}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented by Egland and Greenberg

Sequences we will need to make this XOR gate.

Part Oligos Oligo Design
lpLas' PLasOligos.jpg PLas' oligos diagram.jpg
pLasXOR PLasXOR Oligos.jpg PLasXOR.jpg

Part Forward Primer Reverse Primer
pLux Wtforward.jpg Wtreverse.jpg
pLuxXOR XORforward.jpg XORreverse.jpg

Testing XOR Gate

We will need to have constitutive LasR and LuxR made in these cells.
Then we will need to hit them with the two chemicals AHL types and commercial sources.


Making Better pLac promoter and LacI proteins

LacI wild-type gene sequence (ORF begins at the first amino acid) ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_I12_X86 Mutation
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI Promoter
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG

LacIQ Promoter
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG

LacIQ1 Promoter
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG

-These promoter sequences are taken from Glascock and Weickert 1998

Part Forward Reverse
lacIQ1 Promoter Placiq1 forward.jpg LacIq1reversecomplement.jpg
lacIQ Promoter LacIqforwardprimer.jpg LacIqreversecomplement.jpg
LacI_I12 LacI I12forwardprimer.jpg LacI I12reversecomplement.jpg
LacI LacIforwardprimer.jpg LacIreversecomplement.jpg
LacI_X86 (Primers for step 1 of PCR) LacIforwardprimer.jpg X86 X86I12reversecomplement.jpg
LacI_I12X86 (Primers for step 1 of PCR) LacI I12forwardprimer.jpg X86 X86I12reversecomplement.jpg

Testing Lac promoters and proteins
Construct One
Construct12.jpg
Construct Two
Construct2.jpg
-We will test by ligating each of these constructs together with the 3 different lac promoters and the 4 different Lac proteins. We will measure the output of GFP to characterize the strength of each promoter and protein. We will have 12 constructs all together.