Difference between revisions of "Blasting Spacers for Our Genome"

From GcatWiki
Jump to: navigation, search
 
(Blasting Spacers)
Line 2: Line 2:
  
 
CRISPR one results from CRISPR finder are shown below.  I blasted all of the spacers using the nr/nb database and the results are shown below.
 
CRISPR one results from CRISPR finder are shown below.  I blasted all of the spacers using the nr/nb database and the results are shown below.
 +
 
[[Image:crisperOne.jpg]]
 
[[Image:crisperOne.jpg]]
 +
 +
 +
Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG
 +
[[Image:spacerOne.jpg]]

Revision as of 17:38, 3 November 2009

Blasting Spacers

CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below.

Error creating thumbnail: Unable to save thumbnail to destination


Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG

Error creating thumbnail: Unable to save thumbnail to destination