Difference between revisions of "Mike N"
| Line 16: | Line 16: | ||
tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA | tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA | ||
| + | -'''Scaffold 01561''' 18,500-23,800 | ||
| − | + | ta (X5) at 11,000 product size: 291bp forward primer: TACCTTAAGGCTCCGTTTGTTT reverse primer: TCCATTTGTTTCGATGTACTGG | |
| + | |||
| + | ga (X8) at 37,500 product size: 153bp forward primer: ATCTCCCTACGGTGGGATAAGT reverse primer: AACCTATCGATCCACTCCTTCA | ||
-'''Scaffold 00649''' 28,300-28,600 | -'''Scaffold 00649''' 28,300-28,600 | ||
| + | |||
| + | ga (X6) at 27,600 product size: 245bp forward primer: TTAATTTTGTCCCACCCAAGAC reverse primer: TGAGGGTTCAAAGGACAAAACT | ||
| + | |||
| + | tc (X5) at 30,800 product size: 162bp forward primer: CTCATTGTCAAACGCAGACTTC reverse primer: TGGTAGTCATCAGGATGGTTTG | ||
| Line 35: | Line 42: | ||
== '''Cryptochrome 2 (CRY2)''' == | == '''Cryptochrome 2 (CRY2)''' == | ||
| − | -'''Scaffold 00649''' 16,000-30,000 | + | -'''Scaffold 00649''' 16,000-30,000 (Note this scaffold was also a hit for CRY1) |
| + | |||
| + | tc (X5) at 30,800 product size: 162bp forward primer: CTCATTGTCAAACGCAGACTTC reverse primer: TGGTAGTCATCAGGATGGTTTG | ||
| + | |||
| + | -'''Scaffold 01561''' 20,000-21,000 (Note this scaffold was also a hit for CRY1) | ||
| + | |||
| + | ta (X5) at 11,000 product size: 291bp forward primer: TACCTTAAGGCTCCGTTTGTTT reverse primer: TCCATTTGTTTCGATGTACTGG | ||
| + | |||
| + | ga (X8) at 37,500 product size: 153bp forward primer: ATCTCCCTACGGTGGGATAAGT reverse primer: AACCTATCGATCCACTCCTTCA | ||
| − | |||
| Line 52: | Line 66: | ||
-'''Scaffold 01843''' 40,900-41,000 | -'''Scaffold 01843''' 40,900-41,000 | ||
| + | |||
| + | ac (X6) at 31,800 product size: 285bp forward primer: CCAAGATCCTTCCAAACTAACG reverse primer: TTCTTCTTCTTCTTCGTTTGCC | ||
| + | |||
| + | gaa (X5) at 32,000 product size: 133bp forward primer: AGGGGTTAACAAAACATACCCC reverse primer: TCTCTGGTTCAATTTAGGGCTC | ||
| + | |||
| + | tc (X11) at 48,300 product size: 275bp forward primer: GAAACAGATGGCATGGTGAGTA reverse primer: CTCCAAAACCCTATGAAAGTGC | ||
Revision as of 11:15, 15 March 2012
In order to investigate the timing of blooming in blueberries, I found a paper discussing floral timing in Arabidopsis (Amasino, Richard. (2010) Seasonal and Developmental Timing of Flowering. The Plant Journal, 61, 1001-1013.). In this paper, I found a figure describing the known major genes in the blooming pathway (see below, edited).
To address some of these major genes I first found their sequences in Arabidopsis. Then, using these sequences as queries, I ran a BLASTn against the blueberry 454 scaffolds on the Genome Database site for blueberry we were given access to ([1]). If the matches were relatively weak, a tBLASTx was also run between the ortholog and database, and the top hits were compared to confirm similarity. I then submitted the scaffold(s) that best match(ed) to the 'SSR finder tool' also on the Genome Database site ([2]). The primers were generated by the 'SSR finder tool' and represent those given that were closest to the location of the orthologs, either bi- or tri- nucleotide repeats with at least 5 repeating units, and that produce a product ranging from 100 to 700 base pairs in length.
Click Media: Floral_Timing.pptx for a PowerPoint summarizing what I have done, and briefly what I found.
The following is a complete list of what I found for the eleven genes I investigated.
Contents
Crytochrome 1 (CRY1)
-Scaffold 000331 122,000-129,000
tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA
-Scaffold 01561 18,500-23,800
ta (X5) at 11,000 product size: 291bp forward primer: TACCTTAAGGCTCCGTTTGTTT reverse primer: TCCATTTGTTTCGATGTACTGG
ga (X8) at 37,500 product size: 153bp forward primer: ATCTCCCTACGGTGGGATAAGT reverse primer: AACCTATCGATCCACTCCTTCA
-Scaffold 00649 28,300-28,600
ga (X6) at 27,600 product size: 245bp forward primer: TTAATTTTGTCCCACCCAAGAC reverse primer: TGAGGGTTCAAAGGACAAAACT
tc (X5) at 30,800 product size: 162bp forward primer: CTCATTGTCAAACGCAGACTTC reverse primer: TGGTAGTCATCAGGATGGTTTG
Phytochrome A (PHYA)
-Scaffold 03861' 3,400-5,800
Unfortunately, the scaffold length is only 7,403bp long, so no adequate SSRs were detected and appropriate primers could not be found.
Gigantea (GI)
-Scaffold 00100 192,000-200,600
Cryptochrome 2 (CRY2)
-Scaffold 00649 16,000-30,000 (Note this scaffold was also a hit for CRY1)
tc (X5) at 30,800 product size: 162bp forward primer: CTCATTGTCAAACGCAGACTTC reverse primer: TGGTAGTCATCAGGATGGTTTG
-Scaffold 01561 20,000-21,000 (Note this scaffold was also a hit for CRY1)
ta (X5) at 11,000 product size: 291bp forward primer: TACCTTAAGGCTCCGTTTGTTT reverse primer: TCCATTTGTTTCGATGTACTGG
ga (X8) at 37,500 product size: 153bp forward primer: ATCTCCCTACGGTGGGATAAGT reverse primer: AACCTATCGATCCACTCCTTCA
Phytochrome B (PHYB)
-Scaffold 00751 84,000-89,200
aga (X8) at 81,900 product size: 265bp forward primer: CCCGAAAATACCCTTTCTCTCT reverse primer: GGCAATTACCAATTACGTGTCA
ag (X10) at 92,400 product size: 262bp forward primer: AAGAGGGGTAGACCAAAATTGA reverse primer: AATTTCACTCCAACCAAGAAGG
Constans (CO)
-Scaffold 01843 40,900-41,000
ac (X6) at 31,800 product size: 285bp forward primer: CCAAGATCCTTCCAAACTAACG reverse primer: TTCTTCTTCTTCTTCGTTTGCC
gaa (X5) at 32,000 product size: 133bp forward primer: AGGGGTTAACAAAACATACCCC reverse primer: TCTCTGGTTCAATTTAGGGCTC
tc (X11) at 48,300 product size: 275bp forward primer: GAAACAGATGGCATGGTGAGTA reverse primer: CTCCAAAACCCTATGAAAGTGC
Constitutive Photomorphogenisis 1 (COP1)
-Scaffold 00752 17,000-24,800
ga (X6) at 14,800 product size: 277bp forward primer: CTCCAACTCTGAACTGATTCCC reverse primer: GAAACGCGTCCTTGATTATCTC
-Scaffold 00111 154,000-162,000
ct (X9) at 144,800 product size: 164bp forward primer: GTGGAAAATGTAAAGACACGCA reverse primer: AAAGCTTTCTAACCTCCGATCC
at (X5) at 165,400 product size: 300bp forward primer: CTTTCTTCCACTCAAGCCCTAA reverse primer: GAATCTTGTGCACCACACACTT
Cycling DOF Factor (CDF)
-Scaffold 00079 69,000-69,200
-Scaffold 00651 19,900-20,100
-Scaffold 01102 51,500-51,700
-Scaffold 00292 195,200-195,300
Apetala 1 (AP1)
-Scaffold 00988 71,100-71,200
Flowering Locus T (FT)
-Scaffold 00357 56,800-58,200
Leafy (LFY)
No ortholog could be found in Vaccinium when a BLASTn was run in the 454 scaffold database when the Arabidopsis sequence was used as the query.