Difference between revisions of "Blasting Spacers for Our Genome"
From GcatWiki
Karicheson (talk | contribs) |
Karicheson (talk | contribs) (→Blasting Spacers) |
||
| Line 2: | Line 2: | ||
CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below. | CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below. | ||
| + | |||
[[Image:crisperOne.jpg]] | [[Image:crisperOne.jpg]] | ||
| + | |||
| + | |||
| + | Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG | ||
| + | [[Image:spacerOne.jpg]] | ||
Revision as of 17:38, 3 November 2009
Blasting Spacers
CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below.
Error creating thumbnail: Unable to save thumbnail to destination
Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG
Error creating thumbnail: Unable to save thumbnail to destination