Difference between revisions of "Mike N"

From GcatWiki
Jump to: navigation, search
Line 1: Line 1:
This is my page.
+
In order to investigate the timing of blooming in blueberries, I found a paper discussing floral timing in ''Arabidopsis'' (Amasino, Richard. (2010) Seasonal and Developmental Timing of Flowering. ''The Plant Journal'', '''61''', 1001-1013.). In this paper, I found a figure describing the known major genes in the blooming pathway (see below, edited).
 +
 
 +
 
 +
To address some of these major genes I first found their sequences in ''Arabidopsis''. Then, using these sequences as queries, I ran a BLASTn against the blueberry 454 scaffolds on the Genome Database site for blueberry we were given access to ([dev.vaccinium.org]). I then submitted the scaffold(s) that best match(ed) to the 'SSR finder tool' also on the Genome Database site ([dev.vaccinium.org/node/5897]). The primers were generated by the 'SSR finder tool' and represent those given that were closest to the location of the orthologs, either bi- or tri- nucleotide repeats with at least 5 repeating units, and that produce a product ranging from 100 to 700 base pairs in length.
  
  
Line 8: Line 11:
 
tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA
 
tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA
  
atc (X4) at 122,800 product size: 258bp forward primer: TCCAATACCACTTTCTTCACCC reverse primer: GATAATAGGGCAGAAGTTCCGA
 
  
 
-'''Scaffold 01561''' 18,500-23,800
 
-'''Scaffold 01561''' 18,500-23,800
Line 53: Line 55:
 
ga (X6) at 14,800 product size: 277bp forward primer: CTCCAACTCTGAACTGATTCCC reverse primer: GAAACGCGTCCTTGATTATCTC
 
ga (X6) at 14,800 product size: 277bp forward primer: CTCCAACTCTGAACTGATTCCC reverse primer: GAAACGCGTCCTTGATTATCTC
  
tta (X4) at 25,400 product size: 276bp forward primer: CGTACGAAGATTTGTTCAGCAG reverse primer: GCTACGCAAACATGATGACTTC
 
  
 
-'''Scaffold 00111''' 154,000-162,000
 
-'''Scaffold 00111''' 154,000-162,000
Line 85: Line 86:
 
== '''Leafy (LFY)''' ==
 
== '''Leafy (LFY)''' ==
  
No ortholog could be found in Vaccinium when the Arabidopsis sequence was used as the query.
+
No ortholog could be found in Vaccinium when a BLASTn was run in the 454 scaffold database when the Arabidopsis sequence was used as the query.

Revision as of 09:18, 15 March 2012

In order to investigate the timing of blooming in blueberries, I found a paper discussing floral timing in Arabidopsis (Amasino, Richard. (2010) Seasonal and Developmental Timing of Flowering. The Plant Journal, 61, 1001-1013.). In this paper, I found a figure describing the known major genes in the blooming pathway (see below, edited).


To address some of these major genes I first found their sequences in Arabidopsis. Then, using these sequences as queries, I ran a BLASTn against the blueberry 454 scaffolds on the Genome Database site for blueberry we were given access to ([dev.vaccinium.org]). I then submitted the scaffold(s) that best match(ed) to the 'SSR finder tool' also on the Genome Database site ([dev.vaccinium.org/node/5897]). The primers were generated by the 'SSR finder tool' and represent those given that were closest to the location of the orthologs, either bi- or tri- nucleotide repeats with at least 5 repeating units, and that produce a product ranging from 100 to 700 base pairs in length.


Crytochrome 1 (CRY1)

-Scaffold 000331 122,000-129,000

tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA


-Scaffold 01561 18,500-23,800

-Scaffold 00649 28,300-28,600


Phytochrome A (PHYA)

-Scaffold 03861' 3,400-5,800

Unfortunately, the scaffold length is only 7,403bp long, so no adequate SSRs were detected and appropriate primers could not be found.

Gigantea (GI)

-Scaffold 00100 192,000-200,600


Cryptochrome 2 (CRY2)

-Scaffold 00649 16,000-30,000

-Scaffold 01561 20,000-21,000


Phytochrome B (PHYB)

-Scaffold 00751 84,000-89,200

aga (X8) at 81,900 product size: 265bp forward primer: CCCGAAAATACCCTTTCTCTCT reverse primer: GGCAATTACCAATTACGTGTCA

ag (X10) at 92,400 product size: 262bp forward primer: AAGAGGGGTAGACCAAAATTGA reverse primer: AATTTCACTCCAACCAAGAAGG


Constans (CO)

-Scaffold 01843 40,900-41,000


Constitutive Photomorphogenisis 1 (COP1)

-Scaffold 00752 17,000-24,800

ga (X6) at 14,800 product size: 277bp forward primer: CTCCAACTCTGAACTGATTCCC reverse primer: GAAACGCGTCCTTGATTATCTC


-Scaffold 00111 154,000-162,000

ct (X9) at 144,800 product size: 164bp forward primer: GTGGAAAATGTAAAGACACGCA reverse primer: AAAGCTTTCTAACCTCCGATCC

at (X5) at 165,400 product size: 300bp forward primer: CTTTCTTCCACTCAAGCCCTAA reverse primer: GAATCTTGTGCACCACACACTT


Cycling DOF Factor (CDF)

-Scaffold 00079 69,000-69,200

-Scaffold 00651 19,900-20,100

-Scaffold 01102 51,500-51,700

-Scaffold 00292 195,200-195,300


Apetala 1 (AP1)

-Scaffold 00988 71,100-71,200


Flowering Locus T (FT)

-Scaffold 00357 56,800-58,200


Leafy (LFY)

No ortholog could be found in Vaccinium when a BLASTn was run in the 454 scaffold database when the Arabidopsis sequence was used as the query.