Difference between revisions of "Oligo design for XOR Hybrid Promoters"
| Line 2: | Line 2: | ||
''' | ''' | ||
| − | Mnt/LacI hybrid promoter | + | '''Mnt/LacI hybrid promoter |
| − | + | ''' | |
This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG. | This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG. | ||
| Line 12: | Line 12: | ||
| − | R0073 and R0010 | + | '''[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 R0010]''' |
| − | |||
| − | |||
| − | |||
| − | |||
| + | '''Biobrick prefix''' gaattcgcggccgcttctagag | ||
| − | |||
| − | |||
| − | |||
| + | '''Mnt (everything before and including -10)''' ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt | ||
| − | |||
| − | + | '''LacI last 35bp (everything after -10)''' tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt | |
| − | |||
| + | '''Biobrick suffix''' tactagtagcggccgctgcag | ||
| − | |||
| − | |||
| − | + | '''Entire sequence 138bp''' | |
| − | |||
| − | Entire sequence 138bp | ||
Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc | Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc | ||
| Line 43: | Line 33: | ||
| − | Primers (78bp) | + | '''Primers (78bp)''' |
| − | |||
| − | |||
| − | |||
| − | |||
| + | '''Forward''' gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt | ||
| − | |||
| − | gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatctaggt | + | '''Reverse (reverse complement)''' gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatctaggt |
| Line 61: | Line 47: | ||
| − | Mnt/TetR hybrid promoter | + | '''Mnt/TetR hybrid promoter''' |
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. | This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. | ||
| Line 70: | Line 56: | ||
| − | R0073 and R0040 | + | '''[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073] and [http://partsregistry.org/Part:BBa_R0040 R0040]''' |
| − | |||
| − | |||
| − | |||
| − | |||
| + | '''Biobrick prefix''' gaattcgcggccgcttctagag | ||
| − | |||
| − | ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt | + | '''Mnt (everything before and including -10)''' ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt |
| − | tetR1 | + | '''tetR1''' tccctatcagtgatagaga |
| − | |||
| − | |||
| − | Spacer | + | '''Spacer''' actgta |
| − | |||
| − | actgta | ||
| − | |||
| − | |||
| − | |||
| − | |||
| + | '''TetR 2 binding site''' atccctatcagtgatagagat | ||
| − | |||
| − | tactagtagcggccgctgcag | + | '''Biobrick suffix''' tactagtagcggccgctgcag |
| − | Entire sequence 143bp | + | '''Entire sequence 143bp''' |
Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc | Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc | ||
| − | Primers (81bp) | + | '''Primers (81bp)''' |
| − | Forward | + | '''Forward''' gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag |
| − | gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag | ||
| − | Reverse (reverse complement) | + | '''Reverse (reverse complement)''' gcatctgcagcggccgctactagtaatctctatcactgatagggattctctatcactgatagggaactataggagatct |
| − | gcatctgcagcggccgctactagtaatctctatcactgatagggattctctatcactgatagggaactataggagatct | ||
Revision as of 20:42, 17 June 2008
Oligo design for XOR Hybrid Promoters
Mnt/LacI hybrid promoter This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG.
Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter.
Biobrick prefix gaattcgcggccgcttctagag
Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
LacI last 35bp (everything after -10) tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt
Biobrick suffix tactagtagcggccgctgcag
Entire sequence 138bp
Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc
Primers (78bp)
Forward gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
Reverse (reverse complement) gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatctaggt
Mnt/TetR hybrid promoter
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc.
Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta, but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence.
Biobrick prefix gaattcgcggccgcttctagag
Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
tetR1 tccctatcagtgatagaga
Spacer actgta
TetR 2 binding site atccctatcagtgatagagat
Biobrick suffix tactagtagcggccgctgcag
Entire sequence 143bp
Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc
Primers (81bp)
Forward gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag
Reverse (reverse complement) gcatctgcagcggccgctactagtaatctctatcactgatagggattctctatcactgatagggaactataggagatct
