User contributions
From GcatWiki
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 18:19, 23 May 2012 (diff | hist) . . (+23) . . Summer 2012 SynBio Project (Davidson and MWSU) (→Papers)
- 14:35, 22 May 2012 (diff | hist) . . (+3) . . T7RNAp information page. (current)
- 14:35, 22 May 2012 (diff | hist) . . (+7) . . T7RNAp information page.
- 14:34, 22 May 2012 (diff | hist) . . (+22) . . T7RNAp information page.
- 14:34, 22 May 2012 (diff | hist) . . (0) . . N File:T7 May 22, 2012.pptx (current)
- 16:45, 21 May 2012 (diff | hist) . . (-1) . . Summer 2012 SynBio Project (Davidson and MWSU) (→Student Proposals from Ind. Studies)
- 15:19, 28 April 2012 (diff | hist) . . (+19) . . Annealing Oligos for Cloning
- 19:53, 27 April 2012 (diff | hist) . . (+103) . . Annealing Oligos for Cloning
- 19:47, 27 April 2012 (diff | hist) . . (+5) . . Annealing Oligos for Cloning
- 14:51, 21 January 2012 (diff | hist) . . (+61) . . Annealing Oligos for Cloning
- 14:41, 21 January 2012 (diff | hist) . . (+138) . . Davidson Missouri W/colony PCR (current)
- 14:34, 21 January 2012 (diff | hist) . . (0) . . MWSU protocols
- 14:19, 1 October 2011 (diff | hist) . . (+74) . . Annealing Oligos for Cloning
- 14:17, 1 October 2011 (diff | hist) . . (-14) . . What to do with a new clone (current)
- 14:16, 1 October 2011 (diff | hist) . . (+340) . . Annealing Oligos for Cloning
- 13:54, 1 October 2011 (diff | hist) . . (+631) . . N Annealing Oligos for Cloning (Created page with ' A. Reaction Components: 2 ul 10X PCR buffer w/ 15 mM MgCl2 # Design oligos (the Oligator is a useful tool for this) # Order oligos at 100 uM concentration (eg. IDT) # ul …')
- 13:51, 1 October 2011 (diff | hist) . . (+2) . . Standard PCR
- 13:51, 1 October 2011 (diff | hist) . . (+34) . . MWSU protocols
- 16:04, 30 August 2011 (diff | hist) . . (+3) . . HPP Assembly Procedure (current)
- 16:01, 30 August 2011 (diff | hist) . . (+33) . . HPP Assembly Procedure
- 15:46, 30 August 2011 (diff | hist) . . (-28) . . HPP Assembly Procedure
- 15:46, 30 August 2011 (diff | hist) . . (+754) . . HPP Assembly Procedure
- 15:37, 30 August 2011 (diff | hist) . . (+831) . . N HPP Assembly Procedure (Created page with ''''Edge Assembly''' This assembly uses BsmBI to free up the Half Edge Word in the first and second Half Edges. Ligase drives the reaction toward completion. Equimolar amounts …')
- 15:27, 30 August 2011 (diff | hist) . . (+31) . . Missouri Western/Davidson SynBio 2011
- 20:28, 27 July 2011 (diff | hist) . . (+4) . . HPP New Start and Finish
- 20:28, 27 July 2011 (diff | hist) . . (+10) . . HPP New Start and Finish
- 20:26, 27 July 2011 (diff | hist) . . (+31) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (+4) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (+3) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (+5) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (0) . . HPP New Start and Finish
- 20:24, 27 July 2011 (diff | hist) . . (+8) . . HPP New Start and Finish
- 20:24, 27 July 2011 (diff | hist) . . (-36) . . HPP New Start and Finish
- 20:23, 27 July 2011 (diff | hist) . . (-1) . . HPP New Start and Finish
- 20:23, 27 July 2011 (diff | hist) . . (+8) . . HPP New Start and Finish
- 20:22, 27 July 2011 (diff | hist) . . (+4) . . HPP New Start and Finish
- 20:22, 27 July 2011 (diff | hist) . . (+41) . . HPP New Start and Finish
- 20:20, 27 July 2011 (diff | hist) . . (-454) . . HPP New Start and Finish
- 20:18, 27 July 2011 (diff | hist) . . (+7) . . HPP New Start and Finish
- 20:16, 27 July 2011 (diff | hist) . . (-169) . . HPP New Start and Finish
- 20:11, 27 July 2011 (diff | hist) . . (-1) . . HPP New Start and Finish
- 20:10, 27 July 2011 (diff | hist) . . (+80) . . HPP New Start and Finish
- 20:08, 27 July 2011 (diff | hist) . . (+2,328) . . N HPP New Start and Finish (Created page with 'July 23, 2011 New Oligos to Order START_TOP (67 nt) AATTCGGTCTCAGACGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCGTGGAGAGACGCTGCA START_Bot (59 nt) GCGTCTCTCCACGCTAGCACTGTACCTAGGACTGAGC…')
- 20:07, 27 July 2011 (diff | hist) . . (+33) . . Missouri Western/Davidson SynBio 2011
- 16:21, 6 July 2011 (diff | hist) . . (0) . . N File:GFP1-1 FORWARD AND REVERSE.doc (current)
- 16:21, 6 July 2011 (diff | hist) . . (0) . . N File:RFP2-1 DNA Checked sequence.jpg (current)
- 16:20, 6 July 2011 (diff | hist) . . (+51) . . HPP Oligos 6-9-11 (current)
- 16:19, 6 July 2011 (diff | hist) . . (0) . . N File:RFP2-1 DNA Checked sequence.doc (current)
- 16:17, 6 July 2011 (diff | hist) . . (0) . . File:GFP1-1 FORWARD AND REVERSE.DOC (uploaded a new version of "File:GFP1-1 FORWARD AND REVERSE.DOC") (current)
- 16:15, 6 July 2011 (diff | hist) . . (+51) . . HPP Oligos 6-9-11
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)