Oligo design for XOR Hybrid Promoters

From GcatWiki
Revision as of 20:42, 17 June 2008 by BoCool (talk | contribs)
Jump to: navigation, search

Oligo design for XOR Hybrid Promoters

Mnt/LacI hybrid promoter This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG.

Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter.



R0073 and R0010

Biobrick prefix gaattcgcggccgcttctagag


Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt


LacI last 35bp (everything after -10) tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt


Biobrick suffix tactagtagcggccgctgcag


Entire sequence 138bp

Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc


Primers (78bp)


Forward gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt


Reverse (reverse complement) gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatctaggt




Mnt/TetR hybrid promoter

This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc.

Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta, but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence.


R0073 and R0040


Biobrick prefix gaattcgcggccgcttctagag


Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt


tetR1 tccctatcagtgatagaga


Spacer actgta


TetR 2 binding site atccctatcagtgatagagat


Biobrick suffix tactagtagcggccgctgcag


Entire sequence 143bp

Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc

Primers (81bp)

Forward gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag


Reverse (reverse complement) gcatctgcagcggccgctactagtaatctctatcactgatagggattctctatcactgatagggaactataggagatct