Blasting Spacers for Our Genome

From GcatWiki
Revision as of 17:38, 3 November 2009 by Karicheson (talk | contribs) (Blasting Spacers)
Jump to: navigation, search

Blasting Spacers

CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below.

Error creating thumbnail: Unable to save thumbnail to destination


Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG

Error creating thumbnail: Unable to save thumbnail to destination