Blasting Spacers for Our Genome

From GcatWiki

Revision as of 17:38, 3 November 2009 by Karicheson (talk | contribs) (→‎Blasting Spacers)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Jump to: navigation, search

Blasting Spacers

CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below.

Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG

Retrieved from "https://gcat.davidson.edu/GcatWiki/index.php?title=Blasting_Spacers_for_Our_Genome&oldid=10567"

Navigation menu