Malcolm C
From GcatWiki
Revision as of 20:49, 28 February 2012 by Macampbell (talk | contribs)
This is where I will capture my progress on this project.
I will also be working on the 13 genes Allan gave us.
The class has already completed 4 SSR primer designs (LDOX, CHS, StSy, and F3H).
Results from Blueberry 454 Scaffold Searches from Grape (given to use by Allan Brown) AOMT Scaffold 00796
AOMT scaffold 01781
- Forward Primer GGCGACTGTGTCTTTCAGTAAA & Rev Primer TAGGATTTCGAGGAGGAGAGGT (ct) x7 PCR product = 136 bp
- Forward Primer ATAAACAGGTAAACCGAACCGA & Rev Primer CCGATTAAATTGGAGCAGTAGC (tg) x7 PCR product = 262 bp
ANPER scaffold 00666
CHI scaffold03186
DFR scaffold 03132
F3'H scaffold 01438
FLS scaffold 00142
FLS scaffold 00374
MYBA1 scaffold 03500
MYCA1 scaffold 00278
MYCA1 scaffold 00554
UFGT scaffold 00304
UFGT scaffold 01120