Malcolm C

From GcatWiki
Revision as of 20:49, 28 February 2012 by Macampbell (talk | contribs)
Jump to: navigation, search

This is where I will capture my progress on this project.

I will also be working on the 13 genes Allan gave us.

The class has already completed 4 SSR primer designs (LDOX, CHS, StSy, and F3H).

Results from Blueberry 454 Scaffold Searches from Grape (given to use by Allan Brown) AOMT Scaffold 00796

AOMT scaffold 01781

  1. Forward Primer GGCGACTGTGTCTTTCAGTAAA & Rev Primer TAGGATTTCGAGGAGGAGAGGT (ct) x7 PCR product = 136 bp
  2. Forward Primer ATAAACAGGTAAACCGAACCGA & Rev Primer CCGATTAAATTGGAGCAGTAGC (tg) x7 PCR product = 262 bp


ANPER scaffold 00666

CHI scaffold03186

DFR scaffold 03132

F3'H scaffold 01438

FLS scaffold 00142

FLS scaffold 00374

MYBA1 scaffold 03500

MYCA1 scaffold 00278

MYCA1 scaffold 00554

UFGT scaffold 00304

UFGT scaffold 01120