Aaron D

From GcatWiki
Revision as of 07:04, 15 March 2012 by Aadeal (talk | contribs)
Jump to: navigation, search

Blueberry coat color

Evidence presented by Albrigo et al. (Media:Albrigo_color.pdf) points to "waxy bloom" contributing highly to coat color in highbush blueberries. Other possible variables (such as pH and anthocyanins) were implicated in juice color but showed little to no influence on coat color. Therefore, genes involved in wax production and secretion were the focus of my research.

A direct connection between beta-diketone presence and coat color was made by Sapers et al. (Media:Sapers_color.pdf). Berries with more beta-diketones displayed a higher degree of blue hue. Multiple sources also mentioned a connection between beta-ketones and blue hue on blueberries.

Samuels et al. (Media:Samuels_color.pdf) provided a thorough analysis of wax production in Arabidopsis. Additionally, pathways presented within the paper indicated genes involved in ketone production. Based on the relatedness of two genera, I searched for orthologs of Arabidopsis in the Vaccinium genome. Considerations taken when choosing genes included pathway position, ???

Target genes: MAH1 (ketone production), FATB (wax production), WSD (wax production), CER6 (fatty acid elongation), WBC11 (transporter: wax secretion)

Error creating thumbnail: Unable to save thumbnail to destination

Source: Media:Samuels_color.pdf

Error creating thumbnail: Unable to save thumbnail to destination

Source: Media:Samuels_color.pdf


Finding orthologs

Samuels et al. provided MIPS accession numbers for each gene. Entering each number into The Arabidopsis Information Resource provides links to FASTA sequences for the gene in Arabidopsis. Scaffolds of the V. corymbosum genome containing possible orthologs were found using the tBLASTx tool on the Vaccinium website. Scaffolds were chosen based on E-score. SSRs (and primers for each SSR) were found for each scaffold using the SSR tool on the Vaccinium website. SSRs for Marker Assisted Breeding (MAB) were chosen based on proximity to the region of the scaffold aligning with the submitted Arabidopsis gene. Also, di- and trinucleotide repeats of 5 or greater were favored and PCR products were required to fall between 100 and 700 bp.


Results


FATB


Scaffold 00698

1. Forward Primer GAAGTCTTCACCACTCCGATTC & Reverse Primer TACCACGCAAAATTATCACCAG (tc) x5 PCR product = 281

2. Forward Primer TCCCAATCCAATTGATATCCTC & Reverse Primer TCACTCACCTCTTCCAAGGATT (at) x7 PCR product = 259


WBC11


Scaffold 00913

1. Forward Primer GTGCTAGAATCCCCTGAAACAC & Reverse Primer CCCCCTCTCTCTTTCTTCCTAT (ga) x5 PCR product = 165

2. Forward Primer GTGTGCATCTCTCTCTGATTGC & Reverse Primer TCTCTCCCATCTTAAAACCCAA (ga) x5 PCR product = 132

3. Forward Primer CCGTAAGTAGCGAGGAGACTGT & Reverse Primer ACAAATTCGGACGGAGAGAGTA (ga) x9 PCR product = 227

Scaffold 01191

1. Forward Primer TCAGAGTCACCATCACCGTTAG & Reverse Primer ACTACTACTCGGCAATCGGAAG (cca) x6 PCR product = 256

2. Forward Primer CAATCTATTGAAGGAAGGCTGG & Reverse Primer TCGCAAGCATAGTCACAAACTT (at) x5 PCR product = 269


CER6


Scaffold 00431

1. Forward Primer ATCCGACTTGGTAATTTGATGG & Reverse primer CGGAATGAACACCAACAATAGA (ct) x8 PCR product = 257

2. Forward Primer TGCTGAGTGGTGGAGTTCATTA & Reverse primer AAGCCTTACCGCTCTCCTAACT (att) x5 PCR product = 267

Scaffold 00268

1. Forward Primer ATTGCAGATCCTTCCAGTCAAT & Reverse primer TTAACATGCCATTGTCGAAGAC (tg) x5 PCR product = 222

2. Forward Primer TTTGACGTACTTGAGGTTCACG & Reverse primer AAAGAGAGGAGAGAGAGGGAGG (tc) x5 PCR product = 292

Scaffold 00137

1. Forward Primer AACACCTTGACGAACTGAACCT & Reverse primer CAATCCAGTATTGAGACAGCCA (tc) x5 PCR product = 107

2. Forward Primer AAATTGCTAGAGTTGCCGTTGT & Reverse primer ATCACATGGACTGGTAGAGCCT (tg) x5 PCR product = 139


WSD


Scaffold 00550

1. Forward Primer ATGTTATTCCATCCGCCTCTAA & Reverse primer ACCTCAAACAAATAACCCAACG (ga) x5 PCR product = 190

2. Forward Primer AATTGAGAAATGTGAGTCCCGT & Reverse primer GAGACACGCTAAGATTTGCCTT (at) x5 PCR product = 295


FATB


Scaffold 00698

1. Forward Primer GAAGTCTTCACCACTCCGATTC & Reverse Primer TACCACGCAAAATTATCACCAG (tc) x5 PCR product = 281

2. Forward Primer TCCCAATCCAATTGATATCCTC & Reverse Primer TCACTCACCTCTTCCAAGGATT (at) x7 PCR product = 259