Aaron D

From GcatWiki
Revision as of 19:43, 12 April 2012 by Aadeal (talk | contribs)
Jump to: navigation, search

Blueberry coat color

Evidence presented by Albrigo et al. (Media:Albrigo_color.pdf) points to "waxy bloom" contributing highly to coat color in highbush blueberries. Other possible variables (such as pH and anthocyanins) were implicated in juice color but showed little to no influence on coat color. Also, a direct connection between beta-diketone presence and coat color was made by Sapers et al. (Media:Sapers_color.pdf). Berries with more beta-diketones displayed a higher degree of blue hue. Therefore, genes involved in wax production and secretion and beta-diketone synthesis were the focus of my research.


Samuels et al. (Media:Samuels_color.pdf) provided a thorough analysis of wax production in Arabidopsis. Additionally, pathways presented within the paper and the KEGG website indicated genes involved specifically in ketone production. Based on the relatedness of two genera, I searched for orthologs of Arabidopsis within the Vaccinium scaffold collection. Genes were chosen to represent a variety of roles within wax synthesis and secretion.


Target genes: WBCII (transporter: wax secretion); CER6 (fatty acid elongation); WSD (wax production); FATB (wax production); MAH1 (ketone production)


Arabidopsis wax pathway.jpg

Source: Media:Samuels_color.pdf

Arabidopsis wax secretion.jpg

Source: Media:Samuels_color.pdf

Wax kegg.jpg

Source: KEGG


Finding orthologs

Samuels et al. provided MIPS accession numbers for each gene. Entering each number into The Arabidopsis Information Resource provides links to FASTA sequences for the gene in Arabidopsis. Scaffolds of the V. corymbosum genome containing possible orthologs were found using the tBLASTx tool on the Vaccinium website. Scaffolds were chosen based on E-score. SSRs (and primers for each SSR) were found for each scaffold using the SSR tool on the Vaccinium website. SSRs were chosen based on proximity to the region of the scaffold aligning with the submitted Arabidopsis gene. Also, di- and trinucleotide repeats of 5 or greater were favored and the size of PCR products was required to fall between 100 and 700 bp.


Results


WBCII


Scaffold 00913 (Aligning region: 72307 - 93373 bp)

1. Forward Primer GTGCTAGAATCCCCTGAAACAC & Reverse Primer CCCCCTCTCTCTTTCTTCCTAT (ga) x5 PCR product = 165 (64928 - 64937 bp)

2. Forward Primer GTGTGCATCTCTCTCTGATTGC & Reverse Primer TCTCTCCCATCTTAAAACCCAA (ga) x5 PCR product = 132 (96985 - 96994 bp)

3. Forward Primer CCGTAAGTAGCGAGGAGACTGT & Reverse Primer ACAAATTCGGACGGAGAGAGTA (ga) x9 PCR product = 227 (100495 - 100512 bp)


Scaffold 01191 (Aligning region: 8751 - 13731 bp)

1. Forward Primer TCTTATTGGTCCTCGGTGCTAT & Reverse Primer CACAAAATGGCCTAAGTAGGGA (ca) x5 PCR product = 258 (3896 - 3905 bp)

2. Forward Primer ACTGGAAATGGTAGAAATGGGA & Reverse Primer GAGGAAGAGGAAAAAGGAGGAG (ga) x15 PCR product = 284 (14258 - 14287 bp)


CER6


Scaffold 00431 (Aligning region: 45978 - 48317 bp)

1. Forward Primer ATCCGACTTGGTAATTTGATGG & Reverse primer CGGAATGAACACCAACAATAGA (ct) x8 PCR product = 257 (36598 - 36613 bp)

2. Forward Primer TGCTGAGTGGTGGAGTTCATTA & Reverse primer AAGCCTTACCGCTCTCCTAACT (att) x5 PCR product = 267 (55128 - 55142 bp)


Scaffold 00268 (Aligning region: 190730 - 192192 bp)

1. Forward Primer ATTGCAGATCCTTCCAGTCAAT & Reverse primer TTAACATGCCATTGTCGAAGAC (tg) x5 PCR product = 222 (179241 - 179250 bp)

2. Forward Primer TTTGACGTACTTGAGGTTCACG & Reverse primer AAAGAGAGGAGAGAGAGGGAGG (tc) x5 PCR product = 292 (192395 - 192404 bp)


Scaffold 00137 (Aligning region: 145956 - 147476 bp)

1. Forward Primer AACACCTTGACGAACTGAACCT & Reverse primer CAATCCAGTATTGAGACAGCCA (tc) x5 PCR product = 107 (143881 - 143890 bp)

2. Forward Primer AAATTGCTAGAGTTGCCGTTGT & Reverse primer ATCACATGGACTGGTAGAGCCT (tg) x5 PCR product = 139 (158644 - 158653 bp)


WSD


Scaffold 00550 (Aligning region: 130667 - 130867 bp)

1. Forward Primer ATGTTATTCCATCCGCCTCTAA & Reverse primer ACCTCAAACAAATAACCCAACG (ga) x5 PCR product = 190 (129038 - 129047 bp)

2. Forward Primer AATTGAGAAATGTGAGTCCCGT & Reverse primer GAGACACGCTAAGATTTGCCTT (at) x5 PCR product = 295 (135042 - 135051 bp)


FATB


Scaffold 00698 (Aligning region: 13633 - 18095 bp)

1. Forward Primer GAAGTCTTCACCACTCCGATTC & Reverse Primer TACCACGCAAAATTATCACCAG (tc) x5 PCR product = 281 (11438 - 11447 bp)

2. Forward Primer TCCCAATCCAATTGATATCCTC & Reverse Primer TCACTCACCTCTTCCAAGGATT (at) x7 PCR product = 259 (19774 - 19787 bp)


MAH1


Scaffold 01091 (Aligning region: 124548 - 125522 bp)

1. Forward Primer TGTATTAAAGTGTGTGGGGGTG & Reverse Primer TAGAACACGAAAATGGTGTTGG (tc) x11 PCR product = 184 (95581 - 95602 bp)

2. Forward Primer ATAGGCAAAGAATTTTGGGAGG & Reverse Primer TACACACACACACACACACACA (gtat) x8 PCR product = 129 (130046 - 130077 bp)


Scaffold 00236 (Aligning region: 226568 - 227989 bp)

1. Forward Primer ACCACCACCACCTCTCTCTCT & Reverse Primer AAGGTTTTGATGGCTTACCTCA (tca) x7 PCR product = 148 (226187 - 226207 bp)

2. Forward Primer CTCTTCTCCCCCTTTCATACCT & Reverse Primer CTTCCTGGTGAAGAGAAATTGG (ta) x5 PCR product = 225 (230813 - 230822 bp)



ESTs


WBCII


Scaffold 01191: DR067855 DR067855.jpg


Scaffold 01191: CV190423 File:CV190423


Scaffold 01191: CF811331 CF811331.jpg


Scaffold 00913: DR067166 DR067166.jpg


CER6


Scaffold 00137 and 00268: CF811643 CF811643.jpg


MAH1


Scaffold 01091: DR066987 DR066987.jpg


Scaffold 00236: CV090972 CV090972.jpg