Davidson - Riboswitches
Research
There are 6 different ammeline riboswitches that have been created by Neil Dixon, John N. Duncan, Torsten Geerlings, Mark S. Dunstan, John E. G. McCarthy, David Leys, and Jason Micklefield. Their research is described in the article Reengineering orthogonally selective riboswitches. The article shows that the two best riboswitches seem to be M6 and M6C, however neither of these riboswitches appear to be truly "off". When there is no ammeline present there is still a production of GFP. This presents a problem because when using a fitness module like antibiotic resistance those cells that are not producing ammeline will still be able to live, not allowing for the evolution that we desire. Another problem comes from the fact that the induction factor (the expression when ammeline is present/the expression when ammeline is absent) is not extremely high. Supplemental Information For Article
Figures From Report
Secondary structure model of the parental add A-riboswitch in the ON-state
Data From Testing Different Riboswitches
There are two options that we can do to fix these riboswitch systems
1) Create a better riboswitch that is "off" when ammeline is absent, but still allows for an "on" system when ammeline is present
2) Change the fitness module from antibiotic resistance to a thyA module
Known Riboswitches
Riboswitch AddA
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGTTTCTACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6C
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6’
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6’’
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6C’
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6C"
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6C (A172G Mutation)
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAGAGAGAAGACTATGAAG
Riboswitch M6C (T92C Mutation)
TCAACGCTTCATATAATCCCAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG
Riboswitch M6C’ (T167C Mutation)
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTCTATAAAGAGAAGACTATGAAG
Experimentation
Materials
- 10 riboswitch clones
- LB (amp?) plate for spotting
- LB (amp?) broth - 1 Liter: LB w/ DMSO (control), LB w/ DMSO and ammeline (experiment), LB (growing cells)
- Sterile, Filtered DMSO
- 20 test tubes (10 for freezing, 10 for miniprep and spotting)
- 20 test tubes (10 control w/o ammeline, 10 experiment w/ ammeline)
Outline of Methods
Wednesday 5/28/14:
1) Get riboswitch clones in mail from MWSU
2) Grow 2 (2mL) test tubes of each clone overnight
3) Prepare 5 mL of 5 mM ammeline stock
- Much more difficult than originally thought..will work on this using dilute NaOH, heating DMSO, or possibly using dilute DEA
Thursday 5/29/14:
1) Freeze down cells, put in GCAT-alog
2) Perform miniprep
3) Spot 10 clones on plate, leave to grow until Sunday night
Sunday 6/1/14:
1) Come in and grow cells for experimentation tomorrow
- 2 test tubes for each clone, 1 w/DMSO (control), 1 w/ ammeline dissolved in DMSO (experimental)
Monday 6/2/14:
1) Measure Fluorescence using Synergy Machine
- Find control and experimental
- Find induction factor (experimental/control)
*The collaborating MSWU research and experimentation can be found on MWSU Different Riboswitches
New Ammeline Riboswitches
20 New Davidson Ammeline Riboswitch Sequences File:New Ammeline Riboswitches.docx
| New Ammeline Riboswitches | |||||
|---|---|---|---|---|---|
| Riboswitch | Status | Part Number | Mutations? | ||
| M6-R1 | Sequence verified | Not registered due to promoter mutation | 2: T20C, C852T (also has M6 mutation-A432G) | ||
| M6-R2 | PCR (Cloning) | ||||
| M6-R3 | cPCR | ||||
| M6-R4 | cPCR | ||||
| M6-R5 | cPCR | ||||
| M6-R6 | |||||
| M6-R7 | |||||
| M6-R8 | |||||
| M6-R9 | |||||
| M6-R10 | Sequence verified | [J100163] | M6 Mutation: A431G | ||
| M6"-R1 | Miniprepped | ||||
| M6"-R2 | Sequence verified | ||||
| M6"-R3 | Sequence verified | ||||
| M6"-R4 | Sequence verified | ||||
| M6"-R5 | Miniprepped | ||||
| M6"-R6 | Transformation | ||||
| M6"-R7 | Sequence verified-one mutation | ||||
| M6"-R8 | PCR (Cloning) | ||||
| M6"-R9 | PCR (Cloning) | ||||
| M6"-R10 | Sequence verified-registered | ||||
Process:
PCR (Cloning) > Clean and Concentrate DNA/Gel Purify DNA > GGA > Transformation > cPCR > Miniprep > Sequence Verify
NOTE: "M6 Mutation" refers to the mutation in the original M6 riboswitch (A430G) and this mutation will appear in
different locations in the new riboswitches depending on the lengths of the riboswitches.
