PCR for Bio113
From GcatWiki
Revision as of 20:11, 18 July 2017 by Macampbell (talk | contribs) (Created page with "==Transformations after GGA== You want to do 3 transformations:<br> # a positive control that contains known [http://partsregistry.org/Part:BBa_J04450 PlacI + RBS + RFP] to be...")
Transformations after GGA
You want to do 3 transformations:
- a positive control that contains known PlacI + RBS + RFP to be used for comparison RFP expression.
- your experimental GGA ligation
- your negative control "GGA plasmid only" ligation.
Use all 10 µL of the ligations for a transformation.
J04450 is a transformation positive control because it contains PlacI+RBS+RFP in plasmid pSB1A2.
Pipet 40 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three transformations listed above. Plate all three transformations (with SOC) on LB amp plates.
PCR Verification of Successful GGA
If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).
- Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
- Use these two primers:
- Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
- Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
- PCR product with the original TT still in place is 251 bp
- size of TT that should be removed by GGA is 107 bp