Sequence DNA for Bio113

From GcatWiki
Revision as of 21:21, 18 July 2017 by Macampbell (talk | contribs)
Jump to: navigation, search

Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence

  1. For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
  2. Add water to your DNA until the combined volume is 8 µL.
  3. To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
  4. Record your sample and group name for each barcoded tube you used. You should have 3 eXperimental sequencing reactions to send away. Those working with actClone will have 6 tubes to send away.



Sequencing Primers to confirm Inserts v2.0
113_pClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60 C 65bp upstream first base


113_rClone_SeqFor
AACGTGCTGAAGGTCGTC Tm = 65 C 60bp upstream first base


113_actClone_SeqFor
GCATTAGAAACCGTCCATCG Tm = 64 C 73bp upstream first base
113_actClone SeqRev
CCATTAGAAACCATCCCTCG Tm = 63 C 107bp upstream first base


113_repClone_SeqFor
ACAGCTCTTCGCCTTTAC Tm = 62 C 93bp upstream first base