Sequence DNA for Bio113
From GcatWiki
Revision as of 20:47, 15 November 2017 by Debbiethurtle (talk | contribs) (→Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence)
Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence
- For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
- Add water to your DNA until the combined volume is 8 µL.
- To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
- Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.
Sequencing Primers to confirm Inserts v2.0
113_pClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 65bp upstream first base
113_rClone_SeqFor
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream first base
113_actClone_SeqFor
GCATTAGAAACCGTCCATCG Tm = 64° C 73bp upstream first base
113_actClone SeqRev
CCATTAGAAACCATCCCTCG Tm = 63° C 107bp downstream first base
113_repClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 67bp upstream first base