Difference between revisions of "Sequence DNA for Bio113"

From GcatWiki
Jump to: navigation, search
(Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence)
Line 4: Line 4:
 
# Add water to your DNA until the combined volume is 8 µL.  
 
# Add water to your DNA until the combined volume is 8 µL.  
 
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
 
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 eXperimental sequencing reactions to send away. Those working with actClone will have 6 tubes to send away.  
+
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.  
  
  

Revision as of 21:23, 6 November 2017

Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence

  1. For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
  2. Add water to your DNA until the combined volume is 8 µL.
  3. To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
  4. Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.



Sequencing Primers to confirm Inserts v2.0
113_pClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60 C 65bp upstream first base


113_rClone_SeqFor
AACGTGCTGAAGGTCGTC Tm = 65 C 60bp upstream first base


113_actClone_SeqFor
GCATTAGAAACCGTCCATCG Tm = 64 C 73bp upstream first base
113_actClone SeqRev
CCATTAGAAACCATCCCTCG Tm = 63 C 107bp upstream first base


113_repClone_SeqFor
ACAGCTCTTCGCCTTTAC Tm = 62 C 93bp upstream first base