Sequence DNA for Bio113

Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence

1. For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
2. Add water to your DNA until the combined volume is 8 µL.
3. To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
4. Record your sample and group name for each barcoded tube you used. You should have 3 eXperimental sequencing reactions to send away. Those working with actClone will have 6 tubes to send away.

---

Sequencing Primers to confirm Inserts v2.0 113_pClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60 C 65bp upstream first base


113_rClone_SeqFor
AACGTGCTGAAGGTCGTC Tm = 65 C 60bp upstream first base


113_actClone_SeqFor
GCATTAGAAACCGTCCATCG Tm = 64 C 73bp upstream first base
113_actClone SeqRev
CCATTAGAAACCATCCCTCG Tm = 63 C 107bp upstream first base


113_repClone_SeqFor
ACAGCTCTTCGCCTTTAC Tm = 62 C 93bp upstream first base