This web page is part of the course materials for an undergraduate biology course at Davidson College.

The Hemoglobin Mutagenesis Page

Do Not Print This Page - It requires your interaction online!

This page is designed to help you see what happens when a gene contains a single incorrect nucleotide. The example established here is for sickle cell and uses the beta subunit of human hemoglobin. You may want to find other genes and try them at another time.

Directions to see what happens in sickle cell:

1. Copy and paste the human hemoglobin beta cDNA sequence below into both text boxes.
2. Find this sequence CCTGAG in the second text box. This sequence is about 50 bases from the FIRST base.
3. Change CCTGaG to CCTGtG.
4. Click on the Submit button. Notice that the seventh amino acid has been changed from glutamic acid (E) to valine (V).
5. The reason the text book says that this is the SIXTH amino acid instead of the seventh is because the beginning methionine is trimmed off as a part of post-translational modification when the protein is first made.

It should be noted that when you submit your gene sequences, you are sending the sequences to a computer program. As such, this program has several assumptions:

• The program searches for the first start codon (i.e., ATG) in whatever sequence you insert into the text box and will translate the DNA code from this point onward.
• Consequently, when inputing gene sequences other than human hemoglobin beta, you must make certain that the first start codon that the program encounters is the starting point for the correct reading frame.
• The program will return the primary amino acid sequence that corresponds to your query gene in single letter format. Similar to DNA, biologist have developed a short-hand notation for amino acids. The table provided at the bottom of this page lists the amino acids and their single letter cognates.

Here is the human hemoglobin beta cDNA.

5'-

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGa
GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC
AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG
CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC
TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT
CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA
CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA
CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT
GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

-3'

Wild-type:

Now if you want to, you can make insertions and deletions to see how these types of mutations affect the production of a protein.

JCBN Amino Acid Codes

Return to Biology Course Materials

Return to Biology Homepage

Davidson Search Page

© Copyright 2009 Department of Biology, Davidson College, Davidson, NC 28036

Send comments, questions, and suggestions to: macampbell@davidson.edu

Created on 23 March 2004 by Arthur Clement, Danielle Choi, Parul Karnik,Chris Schamper and Aaron Spivak.