Instructions:
In the first input box, enter all of the genes you would like to include in your optimization in FASTA format.
Example gene entry:
>name of gene1
atttgccttggtctctccctttgtgtattgcatctctatctttcggagaccg
>name of gene2
tctatattattggtatatgtgttttcgagggaaacccgggtgttgttt
>name of gene3
accggtgtgccatctcggaggatagggtgagagaggattccctaatgtga
In the second input box, enter any sequences you would like to target in your genes (restriction sites, for example). Considering the exact order in which the genes are listed in the first input box, type ">" followed immediately by the sequence you would like to target for the corresponding gene in the first text box. The first ">" will correspond to the first gene, the second to the second gene, and so on. If you would like to target the center for any particular gene, then only type ">" for that line. If you enter target sequences out of order or skip a gene, a target sequence could get assigned to the wrong gene. On the output page, you can verify that the target sequences are matched with the correct gene. If you want to target the center of all the genes, you may leave this form blank.
Example target entry:
>ccctttgtgt
>
>ggaggat
Once you have filled out both text boxes with the proper information, press Submit to see your genes listed with their optimal 4-nucleotide word, the word's index in the gene, and some more information about its location.