Difference between revisions of "Mike N"

From GcatWiki
Jump to: navigation, search
Line 7: Line 7:
 
Click [[Media: Floral_Timing.pptx]] for a PowerPoint summarizing what I have done, and briefly what I found.
 
Click [[Media: Floral_Timing.pptx]] for a PowerPoint summarizing what I have done, and briefly what I found.
  
The following is a complete list of what I found for the eleven genes I investigated.  
+
The following is a complete list of what I found for the eleven genes I investigated. Genes are ordered in decending confidence, determined by the e-value of the results of the BLASTn of the top hit (and also decending confidence for the top hit among scaffolds, for genes that had multiple good scaffold hits). The primers are listed in sequential order.
 
 
  
 
== '''Crytochrome 1 (CRY1)''' ==
 
== '''Crytochrome 1 (CRY1)''' ==

Revision as of 11:20, 15 March 2012

In order to investigate the timing of blooming in blueberries, I found a paper discussing floral timing in Arabidopsis (Amasino, Richard. (2010) Seasonal and Developmental Timing of Flowering. The Plant Journal, 61, 1001-1013.). In this paper, I found a figure describing the known major genes in the blooming pathway (see below, edited).

Floral Timing Pathway.jpg

To address some of these major genes I first found their sequences in Arabidopsis. Then, using these sequences as queries, I ran a BLASTn against the blueberry 454 scaffolds on the Genome Database site for blueberry we were given access to ([1]). If the matches were relatively weak, a tBLASTx was also run between the ortholog and database, and the top hits were compared to confirm similarity. I then submitted the scaffold(s) that best match(ed) to the 'SSR finder tool' also on the Genome Database site ([2]). The primers were generated by the 'SSR finder tool' and represent those given that were closest to the location of the orthologs, either bi- or tri- nucleotide repeats with at least 5 repeating units, and that produce a product ranging from 100 to 700 base pairs in length.

Click Media: Floral_Timing.pptx for a PowerPoint summarizing what I have done, and briefly what I found.

The following is a complete list of what I found for the eleven genes I investigated. Genes are ordered in decending confidence, determined by the e-value of the results of the BLASTn of the top hit (and also decending confidence for the top hit among scaffolds, for genes that had multiple good scaffold hits). The primers are listed in sequential order.

Crytochrome 1 (CRY1)

-Scaffold 000331 122,000-129,000

tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA

-Scaffold 01561 18,500-23,800

ta (X5) at 11,000 product size: 291bp forward primer: TACCTTAAGGCTCCGTTTGTTT reverse primer: TCCATTTGTTTCGATGTACTGG

ga (X8) at 37,500 product size: 153bp forward primer: ATCTCCCTACGGTGGGATAAGT reverse primer: AACCTATCGATCCACTCCTTCA

-Scaffold 00649 28,300-28,600

ga (X6) at 27,600 product size: 245bp forward primer: TTAATTTTGTCCCACCCAAGAC reverse primer: TGAGGGTTCAAAGGACAAAACT

tc (X5) at 30,800 product size: 162bp forward primer: CTCATTGTCAAACGCAGACTTC reverse primer: TGGTAGTCATCAGGATGGTTTG


Phytochrome A (PHYA)

-Scaffold 03861' 3,400-5,800

Unfortunately, the scaffold length is only 7,403bp long, so no adequate SSRs were detected and appropriate primers could not be found.

Gigantea (GI)

-Scaffold 00100 192,000-200,600


Cryptochrome 2 (CRY2)

-Scaffold 00649 16,000-30,000 (Note this scaffold was also a hit for CRY1)

tc (X5) at 30,800 product size: 162bp forward primer: CTCATTGTCAAACGCAGACTTC reverse primer: TGGTAGTCATCAGGATGGTTTG

-Scaffold 01561 20,000-21,000 (Note this scaffold was also a hit for CRY1)

ta (X5) at 11,000 product size: 291bp forward primer: TACCTTAAGGCTCCGTTTGTTT reverse primer: TCCATTTGTTTCGATGTACTGG

ga (X8) at 37,500 product size: 153bp forward primer: ATCTCCCTACGGTGGGATAAGT reverse primer: AACCTATCGATCCACTCCTTCA


Phytochrome B (PHYB)

-Scaffold 00751 84,000-89,200

aga (X8) at 81,900 product size: 265bp forward primer: CCCGAAAATACCCTTTCTCTCT reverse primer: GGCAATTACCAATTACGTGTCA

ag (X10) at 92,400 product size: 262bp forward primer: AAGAGGGGTAGACCAAAATTGA reverse primer: AATTTCACTCCAACCAAGAAGG


Constans (CO)

-Scaffold 01843 40,900-41,000

ac (X6) at 31,800 product size: 285bp forward primer: CCAAGATCCTTCCAAACTAACG reverse primer: TTCTTCTTCTTCTTCGTTTGCC

gaa (X5) at 32,000 product size: 133bp forward primer: AGGGGTTAACAAAACATACCCC reverse primer: TCTCTGGTTCAATTTAGGGCTC

tc (X11) at 48,300 product size: 275bp forward primer: GAAACAGATGGCATGGTGAGTA reverse primer: CTCCAAAACCCTATGAAAGTGC


Constitutive Photomorphogenisis 1 (COP1)

-Scaffold 00752 17,000-24,800

ga (X6) at 14,800 product size: 277bp forward primer: CTCCAACTCTGAACTGATTCCC reverse primer: GAAACGCGTCCTTGATTATCTC


-Scaffold 00111 154,000-162,000

ct (X9) at 144,800 product size: 164bp forward primer: GTGGAAAATGTAAAGACACGCA reverse primer: AAAGCTTTCTAACCTCCGATCC

at (X5) at 165,400 product size: 300bp forward primer: CTTTCTTCCACTCAAGCCCTAA reverse primer: GAATCTTGTGCACCACACACTT


Cycling DOF Factor (CDF)

-Scaffold 00079 69,000-69,200

-Scaffold 00651 19,900-20,100

-Scaffold 01102 51,500-51,700

-Scaffold 00292 195,200-195,300


Apetala 1 (AP1)

-Scaffold 00988 71,100-71,200


Flowering Locus T (FT)

-Scaffold 00357 56,800-58,200


Leafy (LFY)

No ortholog could be found in Vaccinium when a BLASTn was run in the 454 scaffold database when the Arabidopsis sequence was used as the query.