Difference between revisions of "Golden Gate Assembly for Bio113"

From GcatWiki
Jump to: navigation, search
 
(6 intermediate revisions by the same user not shown)
Line 10: Line 10:
  
 
'''GGA mixture contains:'''<br>
 
'''GGA mixture contains:'''<br>
−
* 1 µL (40 nM) plasmid containing your receiving plasmid (pClone, or rClone, or actClone, or repClone)<br>  
+
* 1 µL (40 nM) plasmid containing your receiving plasmid (pClone)<br>  
 
* 6 µL dH<sub>2</sub>O <br>  
 
* 6 µL dH<sub>2</sub>O <br>  
 
* 1 µL 10X Promega Ligase Buffer<br>  
 
* 1 µL 10X Promega Ligase Buffer<br>  
−
* 0.5 µL Bsa I high fidelity (HF) restriction enzyme<br>  
+
* 0.5 µL Bsa I high fidelity (HFv2) restriction enzyme<br>  
 
* <u>0.5 µL T4 DNA ligase from Promega</u><br>  
 
* <u>0.5 µL T4 DNA ligase from Promega</u><br>  
 
* 9 µL final volume <br> <br>  
 
* 9 µL final volume <br> <br>  
  
−
Turn on the PCR machine. Put '''both''' of your tubes into the machine. <br>  
+
Turn on the thermocycler. Put '''both''' of your tubes into the machine. <br>  
 
Program it for the following cylces: <br>  
 
Program it for the following cylces: <br>  
−
* 20 cycles of 37C for 1 minute/16C for 1 minute <br>  
+
* 20 cycles of 37C for 1.5 minute and 16C for 1.5 minute <br>  
−
* 1 cycle of 37C for 15 minutes <br>
+
* 37C for 3 minutes<br>
 
* 22C holding temperature <br>  
 
* 22C holding temperature <br>  
 +
* heated lid on
 +
 
This DNA ligation is ready for transformation. <br> <br>  
 
This DNA ligation is ready for transformation. <br> <br>  
  
 
You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.
 
You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.
−
 
−
==Transformations after GGA==
 
−
You want to do 3 transformations:<br>
 
−
# a positive control that contains known [http://partsregistry.org/Part:BBa_J04450 PlacI + RBS + RFP] to be used for comparison RFP expression. <br>
 
−
# your experimental GGA ligation<br>
 
−
# your negative control "GGA plasmid only" ligation.<br><br>
 
−
Use all 10 µL of the ligations for a [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transformation]. <br>
 
−
[http://partsregistry.org/Part:BBa_J04450 J04450] is a transformation positive control because it contains PlacI+RBS+RFP in plasmid pSB1A2. <br>  <br>
 
−
 
−
Pipet 40 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transformations] listed above. Plate all three transformations (with SOC) on LB amp plates.<br>  <br>
 
−
 
−
==PCR Verification of Successful GGA==
 
−
If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).
 
−
# Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
 
−
# Use these two primers:
 
−
* Forward = 5’ GAATTCGCGGCCGCTTCTAG  3’
 
−
* Reverse = 5’ TTTGATAACATCTTCGGAGG  3’
 
−
* PCR product with the original TT still in place is 251 bp
 
−
* size of TT that should be removed by GGA is 107 bp
 
  
  
 
This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.
 
This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.

Latest revision as of 14:02, 5 February 2020

Starting with Boiled then Cooled Oligos

  1. You should have already used the Oligator to design your oligos for your dsDNA control element.
  2. You should have already calculated how to dilute your boiled and cooled oligos from 5 µM to 40 nM.

Protocol Details for GGA

  1. You will be given two tubes. One tube will be labeled "X" for eXperimental DNA, the other "N" for the negative control that contains plasmid only. Put your initials on the tubes and return the tubes to ice. These tubes will already contain 9 µL of the GGA Mixture.
  2. Add 1 µL diluted oligos cooled overnight to the tube labeled X for the experimental DNA.
  3. Add 1 µL water to the tube labeled N for the negative control"

GGA mixture contains:

  • 1 µL (40 nM) plasmid containing your receiving plasmid (pClone)
  • 6 µL dH2O
  • 1 µL 10X Promega Ligase Buffer
  • 0.5 µL Bsa I high fidelity (HFv2) restriction enzyme
  • 0.5 µL T4 DNA ligase from Promega
  • 9 µL final volume

Turn on the thermocycler. Put both of your tubes into the machine.
Program it for the following cylces:

  • 20 cycles of 37C for 1.5 minute and 16C for 1.5 minute
  • 37C for 3 minutes
  • 22C holding temperature
  • heated lid on

This DNA ligation is ready for transformation.

You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.


This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.