Difference between revisions of "Golden Gate Assembly protocol"

From GcatWiki
Jump to: navigation, search
(→‎Starting wtih Promoter already cloned in a Plasmid)
 
(7 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
<center>'''Protocol to insert new promoter made into pSB1A2 that contains [http://partsregistry.org/Part:BBa_J119044 BBa_J119044]'''</center><br>  <br>
+
<center>'''Protocol to insert new promoter made into pSB1A2 that contains [http://partsregistry.org/Part:BBa_J100091 BBa_J100091]'''</center><br>  <br>
  
 
==Starting with Boiled then Cooled Oligos==
 
==Starting with Boiled then Cooled Oligos==
 
# You should have already used the [http://gcat.davidson.edu/iGem10/index.html Oligator] to design your oligos for self-assembly into dsDNA. You can take advantage of Oligator's capacity to add the sticky ends onto your oligos, or you can do that yourself. Oligator can also add the BsaI restriction sites onto your DNA which will be cut off by BsaI enzyme in the GGA mixture. <br>
 
# You should have already used the [http://gcat.davidson.edu/iGem10/index.html Oligator] to design your oligos for self-assembly into dsDNA. You can take advantage of Oligator's capacity to add the sticky ends onto your oligos, or you can do that yourself. Oligator can also add the BsaI restriction sites onto your DNA which will be cut off by BsaI enzyme in the GGA mixture. <br>
−
# Go to the [http://gcat.davidson.edu/SynBio12/ Loligator web page] to determine how  to prepare your oligos to add to the solution described below. <br>
 
 
# Use the protocol for [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html boiling oligos to assemble dsDNA].  
 
# Use the protocol for [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html boiling oligos to assemble dsDNA].  
 +
# Determine how many ng of insert you will need in GGA (below) using this formula X ng of insert = (bp insert) (50 ng linearized plasmid-) ÷ (size of entire plasmid in bp) <br>
  
−
If you don't have time to ethanol precipitate and quantify your DNA, you can use this shortcut:
+
 
 +
If you don't want to calculate exactly how many ng you need, you can use this approximation for short segments of DNA:
 
* 1 µL cooled oligos.
 
* 1 µL cooled oligos.
 
* 99 µL water to make a 100X dilution.
 
* 99 µL water to make a 100X dilution.
Line 12: Line 13:
  
 
<br>
 
<br>
−
 
−
==Starting wtih Promoter already cloned in a Plasmid==
 
−
You can start with [http://partsregistry.org/Part:BBa_J119022 BBa_J119022] which contains a promoter that is flanked by BsaI sites. <br>
 
−
Use 50 ng of this plasmid for your "insert" DNA to be added to the ligation mixture listed below. <br><br>
 
  
 
==Protocol Details for GGA==
 
==Protocol Details for GGA==
Line 21: Line 18:
 
# Get '''two''' new, small microfuge tubes designed to fit into the PCR machine.   
 
# Get '''two''' new, small microfuge tubes designed to fit into the PCR machine.   
 
# One tube will be labeled "ligation", the other "plasmid only". Also put your initials on the tubes.
 
# One tube will be labeled "ligation", the other "plasmid only". Also put your initials on the tubes.
−
# 1 µL diluted oligos cooled overnight (''use water instead for "plasmid only" tube''). If you are using [http://partsregistry.org/Part:BBa_J119022 BBa_J119022], use 50 ng in 1 µL volume.
+
# 1 µL diluted oligos cooled overnight (''use water instead for "plasmid only" tube'').  
−
# 9 µL '''ligation mixture''' provided by your instructor.
+
# 9 µL '''GGA mixture'''  
−
# Use the promoter DNA for the ligation tube but use only water for the plasmid only tube. <br> <br>  
+
# Use the boiled and cooled promoter DNA for the ligation tube but use only water for the plasmid only tube. <br> <br>  
  
−
'''Ligation mixture contains:'''<br>
+
'''GGA mixture contains:'''<br>
−
1 µL (50 ng) plasmid containing [http://partsregistry.org/Part:BBa_J119044 part J119044]<br>  
+
1 µL (50 ng) plasmid containing receiving plasmid such as [http://partsregistry.org/Part:BBa_J119137 part J119137]<br>  
−
5 µL dH<sub>2</sub>O <br>  
+
6 µL dH<sub>2</sub>O <br>  
−
1 µL 10X Promega Ligase Buffer<br>
+
1 µL 10X NEB Ligase Buffer<br>  
−
1 µL 500 mM KOAc<br>  
+
0.5 µL Bsa I high fidelity (HFv2) restriction enzyme<br>  
−
0.5 µL Bsa I high fidelity (HF) restriction enzyme<br>  
+
<u>0.5 µL T4 DNA ligase from NEB</u><br>  
−
<u>0.5 µL T4 DNA Ligase</u><br>  
 
 
9 µL final volume <br> <br>  
 
9 µL final volume <br> <br>  
  
−
Turn on the PCR machine. Put '''both''' of your tubes into the machine. <br>  
+
Turn on the thermocycler machine. Put '''both''' of your tubes into the machine. <br>  
 
Program it for the following cylces: <br>  
 
Program it for the following cylces: <br>  
 
* 20 cycles of 37C for 1 minute/16C for 1 minute <br>  
 
* 20 cycles of 37C for 1 minute/16C for 1 minute <br>  

Latest revision as of 06:07, 3 March 2019

Protocol to insert new promoter made into pSB1A2 that contains BBa_J100091


Starting with Boiled then Cooled Oligos

  1. You should have already used the Oligator to design your oligos for self-assembly into dsDNA. You can take advantage of Oligator's capacity to add the sticky ends onto your oligos, or you can do that yourself. Oligator can also add the BsaI restriction sites onto your DNA which will be cut off by BsaI enzyme in the GGA mixture.
  2. Use the protocol for boiling oligos to assemble dsDNA.
  3. Determine how many ng of insert you will need in GGA (below) using this formula X ng of insert = (bp insert) (50 ng linearized plasmid-) ÷ (size of entire plasmid in bp)


If you don't want to calculate exactly how many ng you need, you can use this approximation for short segments of DNA:

  • 1 µL cooled oligos.
  • 99 µL water to make a 100X dilution.
  • Use 1 µL of the 100X diluted oligos and add to the 9 µL described below.


Protocol Details for GGA

  1. Get two new, small microfuge tubes designed to fit into the PCR machine.
  2. One tube will be labeled "ligation", the other "plasmid only". Also put your initials on the tubes.
  3. 1 µL diluted oligos cooled overnight (use water instead for "plasmid only" tube).
  4. 9 µL GGA mixture
  5. Use the boiled and cooled promoter DNA for the ligation tube but use only water for the plasmid only tube.

GGA mixture contains:
1 µL (50 ng) plasmid containing receiving plasmid such as part J119137
6 µL dH2O
1 µL 10X NEB Ligase Buffer
0.5 µL Bsa I high fidelity (HFv2) restriction enzyme
0.5 µL T4 DNA ligase from NEB
9 µL final volume

Turn on the thermocycler machine. Put both of your tubes into the machine.
Program it for the following cylces:

  • 20 cycles of 37C for 1 minute/16C for 1 minute
  • 1 cycle of 37C for 15 minutes
  • 22C holding temperature

This DNA ligation is ready for transformation.

You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.

Transformations after GGA

You want to do 3 transformations:

  1. a positive control that contains known promoter + RBS + RFP to be used for comparison RFP expression.
  2. your experimental ligation
  3. your negative control ligation

Use all 10 µL of the ligations for a transformation.
You will want to perform a transformation positive control using K315008 which contains pLacI+RBS+RFP in plasmid pSB1A2.

Use between 20 - 50 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three transformations listed above. Plate all three transformations on LB amp plates.

PCR Verification of Successful GGA

If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).

  1. Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
  2. Use these two primers:
  • Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
  • Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
  • PCR product with the original TT still in place is 251 bp
  • size of TT that should be removed by GGA is 107 bp


This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.