Difference between revisions of "Golden Gate Assembly for Bio113"

From GcatWiki
Jump to: navigation, search
Line 15: Line 15:
  
 
# Get '''two''' new, small microfuge tubes designed to fit into the PCR machine.   
 
# Get '''two''' new, small microfuge tubes designed to fit into the PCR machine.   
−
# One tube will be labeled "GGA ligation", the other "GGA plasmid only". Put your initials on the tubes. These tubes will already contain 9 µL of the GGA Mixture.
+
# One tube will be labeled "GGA ligation", the other "GGA plasmid only". Put your initials on the tubes and return the tubes to ice. These tubes will already contain 9 µL of the GGA Mixture.
 
# Add 1 µL '''diluted''' oligos cooled overnight to the tube labeled GGA ligation.
 
# Add 1 µL '''diluted''' oligos cooled overnight to the tube labeled GGA ligation.
 
# Add 1 µL water to the tube labeled "GGA plasmid only"
 
# Add 1 µL water to the tube labeled "GGA plasmid only"

Revision as of 15:38, 14 September 2012

Protocol to insert new promoter made into pSB1A2-BR that contains BBa_J100091. THis plasmid is 3005 bp in size.


Starting with Boiled then Cooled Oligos

  1. You should have already used the Oligator to design your oligos for your dsDNA promoter.
  2. Go to the Loligator web page to determine how to prepare your oligos to add to the solution described below.

If you don't have time to quantify your DNA, you can use this shortcut:

  • 1 µL cooled oligos.
  • 99 µL water to make a 100X dilution.
  • Use 1 µL of the 100X diluted oligos and add to the 9 µL described below.


Protocol Details for GGA

  1. Get two new, small microfuge tubes designed to fit into the PCR machine.
  2. One tube will be labeled "GGA ligation", the other "GGA plasmid only". Put your initials on the tubes and return the tubes to ice. These tubes will already contain 9 µL of the GGA Mixture.
  3. Add 1 µL diluted oligos cooled overnight to the tube labeled GGA ligation.
  4. Add 1 µL water to the tube labeled "GGA plasmid only"

GGA mixture contains:
1 µL (50 ng) plasmid containing part J100091 which is 3005 bp in size
5 µL dH2O
1 µL 10X Promega Ligase Buffer
1 µL 500 mM KOAc
0.5 µL Bsa I high fidelity (HF) restriction enzyme
0.5 µL T4 DNA Ligase
9 µL final volume

Turn on the PCR machine. Put both of your tubes into the machine.
Program it for the following cylces:

  • 20 cycles of 37C for 1 minute/16C for 1 minute
  • 1 cycle of 37C for 15 minutes
  • 22C holding temperature

This DNA ligation is ready for transformation.

You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.

Transformations after GGA

You want to do 3 transformations:

  1. a positive control that contains known PlacI + RBS + RFP to be used for comparison RFP expression.
  2. your experimental GGA ligation
  3. your negative control "GGA plasmid only" ligation.

Use all 10 µL of the ligations for a transformation.
J04450 is a transformation positive control because it contains PlacI+RBS+RFP in plasmid pSB1A2.

Use between 50 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three transformations listed above. Plate all three transformations on LB amp plates.

PCR Verification of Successful GGA

If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).

  1. Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
  2. Use these two primers:
  • Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
  • Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
  • PCR product with the original TT still in place is 251 bp
  • size of TT that should be removed by GGA is 107 bp


This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.