IGEM 2010 Project

From GcatWiki
Revision as of 19:19, 17 June 2010 by Dwagner5 (talk | contribs) (→‎Biology Sub-Projects)
Jump to: navigation, search


We need to start capturing what we are doing, and why.

Please use this page as a starting place.

We need an overall description of our project at the overview level as well as the subsections and phases of implementation.

Math Sub-Projects

Counting Permutations


Improving Oligo Assembler We adapted the lancelator (http://gcat.davidson.edu/IGEM06/oligo.html), a program created by Lance Harden as a part of the 2006 iGem team, so that it would execute faster and can handle longer sequences. The old program could only handle sequences of 300 bp or shorter. Also, the more oligos the program broke the sequence into, the longer it took to run, and for 8 or more the run time was simply unreasonable. However, for the sequences it could handle it always finds the optimal oligos to use. Our program allows the user to enter a sequence of any length, and the length does not significantly effect runtime. In addition, we added extra features such as checking for and removing BioBrick restriction sites and adding BioBrick primers. While our program does not always find the optimal oligos, it still does very well which is an acceptable compromise because the runtime is improved so dramatically.

http://gcat.davidson.edu/iGem10/index.html

Biology Sub-Projects

Codon Optimization


Segment Number of Base Pairs Wild Type Sequence Optimized Sequence Deoptimized Sequence
1 141 Atgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcataggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtg ATGAAATCTAACAACGCGCTGATCGTTATCCTGGGTACCGTTACCCTGGACGCGGTTGGTATCGGTCTGGTTATGCCGGTTCTGCCGGGTCTGCTGCGTGACATCGTTCACTCTGACTCTATCGCGTCTCACTACGGTGTT ATGAAGAGTAATAATGCCCTAATAGTCATACTAGGAACAGTCACACTAGATGCCGTCGGAATAGGACTCGTCATGCCCGTCCTACCCGGACTACTAAGGGATATAGTCCATAGTGATAGTATAGCCAGTCATTATGGAGTC
2 138 ctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgcttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctg CTGTACGCGCTGATGCAGTTCCTGTGCGCGCCGGTTCTGGGTGCGCTGTCTGACCGTTTCGGTCGTCGTCCGGTTCTGCTGGCGTCTCTGCTGGGTGCGACCATCGACTACGCGATCATGGCGACCACCCCGGTTCTG CTATATGCCCTAATGCAATTTCTATGTGCCCCCGTCCTAGGAGCCCTAAGTGATAGGTTTGGAAGGAGGCCCGTCCTACTAGCCAGTCTACTAGGAGCCACAATAGATTATGCCATAATGGCCACAACACCCGTCCTA
3 177 tacgccggacgcatcgtggccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctcc TACGCGGGTCGTATCGTTGCGGGTATCACCGGTGCGACCGGTGCGGTTGCGGGTGCGTACATCGCGGACATCACCGACGGTGAAGACCGTGCGCGTCACTTCGGTCTGATGTCTGCGTGCTTCGGTGTTGGTATGGTTGCGGGTCCGGTTGCGGGTGGTCTGCTGGGTGCGATCTCT TATGCCGGAAGGATAGTCGCCGGAATAACAGGAGCCACAGGAGCCGTCGCCGGAGCCTATATAGCCGATATAACAGATGGAGAGGATAGGGCCAGGCATTTTGGACTAATGAGTGCCTGTTTTGGAGTCGGAATGGTCGCCGGACCCGTCGCCGGAGGACTACTAGGAGCCATAAGT
4 81 ccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagag CCGTTCCTGGCGGCGGCGGTTCTGAACGGTCTGAACCTGCTGCTGGGTTGCTTCCTGATGCAGGAATCTCACAAAGGTGAA CCCTTTCTAGCCGCCGCCGTCCTAAATGGACTAAATCTACTACTAGGATGTTTTCTAATGCAAGAGAGTCATAAGGGAGAG

Note: All above segments have been optimized and deoptimized using the online Optimizer program[1]

To create the optimized and deoptimized segments of the Tet A gene we used the sequence that the Optimizer program gave us and put it into the Lancelator[2] a program created by Lance Harden as part of the 2006 iGEM team. At this time we have ordered Oligo parts for segments 1 and 2 of the Tet A gene. The Oligos that were ordered can be seen below.

Tet-trations



Making and Testing lox_ Sites

Green Part has been cloned and sequence verified; Red Part is under construction

Final Construct Current Status Registry Number and Link Primary Team Member
lox5171 Forward in pSB1A2 I got colonies on my second attempt. Once I isolate the plasmid, it will be sent off for sequencing. pSB1A2
lox5171 does not exist in the registry. We ordered oligos and constructed the site in the lab.
Nitya
lox5171 Reverse in pSB1A2 This plasmid will also be sent off for sequencing soon. pSB1A2
lox5171 does not exist in the registry. We ordered oligos and constructed the site in the lab.
Nitya
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here


Testing Cre Activity

Green Part has been cloned and sequence verified; Red Part is under construction

Final Construct Current Status Registry Number and Link Primary Team Member
I718008 (pBAD+RBS+cre) in pSB4K5 At this point, I have isolated both the insert and the plasmid, but my two attempts at ligation have not produced any colonies. I718008 pSB4K5
Nitya
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here
Insert Info Here what is built so far? change to correct link
describe intermediate
your name here