Revision history of "Design of C dog oligos in J-GGA Scaffold for Scaffold 2.0"

From GcatWiki
Jump to: navigation, search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 17:09, 30 July 2013‎ Spolpitiyaarachchige (talk | contribs)‎ . . (577 bytes) (+577)‎ . . (Created page with "C dog for scaffold 2.0 BD18 (medium) >BBa_J119024 Part-only sequence (88 bp) gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatg Oligo...")
Retrieved from "https://gcat.davidson.edu/GcatWiki/index.php?title=Design_of_C_dog_oligos_in_J-GGA_Scaffold_for_Scaffold_2.0"