Revision history of "J-GGA promoter sequences"

From GcatWiki
Jump to: navigation, search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 04:51, 10 June 2013‎ Spolpitiyaarachchige (talk | contribs)‎ . . (1,851 bytes) (+1,851)‎ . . (Created page with "Design of promoters for use in J-GGA Scaffold Promoters Used P5 highest J119031 BBa_J119031 Part-only sequence (36 bp) ttgacaattaatcatccggctcgtaatttatgtgga P14 medium J11...")
Retrieved from "https://gcat.davidson.edu/GcatWiki/index.php?title=J-GGA_promoter_sequences"