Revision history of "Primer Design for the RFP"

From GcatWiki
Jump to: navigation, search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 17:11, 30 July 2013Spolpitiyaarachchige (talk | contribs). . (1,142 bytes) (+1,142). . (Created page with "RFP for scaffold 2.0 Forward primer will bind to 5’ end of RFP JGGA2.0_RFP_for; GCATGGTCTCTGCGAGCTTCCTCCGAAGACGTTATC Reverse primer will to 3’ end of RFP JGGA2.0_RFP_r...")