IGEM 2010 Project
We need to start capturing what we are doing, and why.
Please use this page as a starting place.
We need an overall description of our project at the overview level as well as the subsections and phases of implementation.
Math Sub-Projects
Counting Permutations
Improving Oligo Assembler We adapted the lancelator (http://gcat.davidson.edu/IGEM06/oligo.html), a program created by Lance Harden as a part of the 2006 iGem team, so that it would execute faster and can handle longer sequences. The old program could only handle sequences of 300 bp or shorter. Also, the more oligos the program broke the sequence into, the longer it took to run, and for 8 or more the run time was simply unreasonable. However, for the sequences it could handle it always finds the optimal oligos to use. Our program allows the user to enter a sequence of any length, and the length does not significantly effect runtime. In addition, we added extra features such as checking for and removing BioBrick restriction sites and adding BioBrick primers. While our program does not always find the optimal oligos, it still does very well which is an acceptable compromise because the runtime is improved so dramatically.
http://gcat.davidson.edu/iGem10/index.html
Biology Sub-Projects
Codon Optimization
Segment | Number of Base Pairs | Wild Type Sequence | Optimized Sequence | Deoptimized Sequence |
---|---|---|---|---|
1 | 141 | Atgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggat
gctgtaggcataggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtg || ATGAAATCTAACAACGCGCTGATCGTTATCCTGGGTACCGTTACCCTGGACGCGGTTGGTATCGGTCTGGTTATGCCGGTTCTGCCGGGTCTGCTGCGTGACATCGTTCACTCTGACTCTATCGCGTCTCACTACGGTGTT || ATGAAGAGTAATAATGCCCTAATAGTCATACTAGGAACAGTCACACTAGATGCCGTCGGAATAGGACTCGTCATGCCCGTCCTACCCGGACTACTAGGGATATAGTCCATAGTGATAGTATAGCCAGTCATTATGGAGTC | ||
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here | |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here | |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here | |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here | |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
</center>
Tet-trations
Making and Testing lox_ Sites
Green Part has been cloned and sequence verified; Red Part is under construction
Final Construct | Current Status | Registry Number and Link | Primary Team Member |
---|---|---|---|
lox5171 Forward in pSB1A2 | I got colonies on my second attempt. Once I isolate the plasmid, it will be sent off for sequencing. | pSB1A2 lox5171 does not exist in the registry. We ordered oligos and constructed the site in the lab. |
Nitya |
lox5171 Reverse in pSB1A2 | This plasmid will also be sent off for sequencing soon. | pSB1A2 lox5171 does not exist in the registry. We ordered oligos and constructed the site in the lab. |
Nitya |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Testing Cre Activity
Green Part has been cloned and sequence verified; Red Part is under construction
Final Construct | Current Status | Registry Number and Link | Primary Team Member |
---|---|---|---|
I718008 (pBAD+RBS+cre) in pSB4K5 | At this point, I have isolated both the insert and the plasmid, but my two attempts at ligation have not produced any colonies. | I718008 pSB4K5 |
Nitya |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |
Insert Info Here | what is built so far? | change to correct link describe intermediate |
your name here |