Golden Gate Assembly for Bio113

Starting with Boiled then Cooled Oligos

1. You should have already used the Oligator to design your oligos for your dsDNA control element.
   
2. You should have already calculated how to dilute your boiled and cooled oligos from 5 µM to 40 nM.
   

Protocol Details for GGA

1. You will be given two tubes. One tube will be labeled "X" for eXperimental DNA, the other "N" for the negative control that contains plasmid only. Put your initials on the tubes and return the tubes to ice. These tubes will already contain 9 µL of the GGA Mixture.
2. Add 1 µL diluted oligos cooled overnight to the tube labeled X for the experimental DNA.
3. Add 1 µL water to the tube labeled N for the negative control"

GGA mixture contains:

• 1 µL (40 nM) plasmid containing part J119137 which is 3671 bp in size
  
• 6 µL dH₂O
  
• 1 µL 10X Promega Ligase Buffer
  
• 0.5 µL Bsa I high fidelity (HF) restriction enzyme
  
• 0.5 µL T4 DNA ligase from Promega
  
• 9 µL final volume
  
  

Turn on the PCR machine. Put both of your tubes into the machine.
Program it for the following cylces:

• 20 cycles of 37C for 1 minute/16C for 1 minute
  
• 1 cycle of 37C for 15 minutes
  
• 22C holding temperature
  

This DNA ligation is ready for transformation.

You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.

Transformations after GGA

You want to do 3 transformations:

1. a positive control that contains known PlacI + RBS + RFP to be used for comparison RFP expression.
   
2. your experimental GGA ligation
   
3. your negative control "GGA plasmid only" ligation.
   
   

Use all 10 µL of the ligations for a transformation.
J04450 is a transformation positive control because it contains PlacI+RBS+RFP in plasmid pSB1A2.

Pipet 40 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three transformations listed above. Plate all three transformations (with SOC) on LB amp plates.

PCR Verification of Successful GGA

If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).

1. Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
2. Use these two primers:

• Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
• Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
• PCR product with the original TT still in place is 251 bp
• size of TT that should be removed by GGA is 107 bp

This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.