Difference between revisions of "Davidson Protocols"
From GcatWiki
Macampbell (talk | contribs) |
Macampbell (talk | contribs) |
||
Line 76: | Line 76: | ||
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site] | # [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site] | ||
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks] | # [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks] | ||
− | # [http://www.promega.com/biomath/ | + | # [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega T<sub>m</sub> Calculator] |
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion T<sub>m</sub> Calculator] | # [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion T<sub>m</sub> Calculator] | ||
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos] | # [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos] |
Revision as of 20:31, 25 February 2016
A. General Lab Information
- How to Keep a Lab Notebook
- Common molecular reagents
- Open Access Libraries
- Standard Assembly
- BioBrick Ends
- Compatibility of Plasmids
- Ethanol Precipitate to clean DNA (short protocol)
- glycerolstocks How to Make Glycerol Stocks of Bacteria
- Pipet Tip Olympic Records
B. Gel Electrophoresis and Purification
- Pouring an agarose gel
- Calculate MWs
- 1kb Plus MW markers
- Macherey-Nagel Gel Purification (improved 260/230 ratios)l
- Qiagen QIAquick Gel Purification
- Qiagen QIAquick Column Regeneration Protocol
- ElectroElute Gel Purification
C. Digestion, Ligation, Transformation
- Digest DNA with restriction enzymes
- Double Digest Guide
- NEB Double Digestion Guide
- Shrimp Alkaline Phosphatase
- Ligation Protocol
- Choices for Transformation: Heat Shock vs. Zyppy
- Heat Shock Transformation OR Short version of Heat Shock
- Zippy Transformation
- TSS Competent Cell Transformation
- Golden Gate Assembly protocol (GGA with BsaI)
- Golden_Gate_Assembly_Protocol_for_BsmB1 (GGA with BsmBI) written by collaborators at MWSU
- GGA for BsmBI modified to do everything in one tube
- NEB GGA Assembler
- Electroporation_Transformation written by collaborators at MWSU
D. Minipreps
E. Making New Parts and PCR
- Building dsDNA with Oligos
- Annealing_Oligos_for_Cloning Calculate how to mix boiled oligos with 50 ng of receiving plasmid.
- The Loligator
- Setting up PCR mixtures
- PCR and Mg2+ concentration
- isolate genomic DNA from a single hair follicle
- Prepare PCR product for sequencing after clean and concentration procedure (for Bio113 lab use)
- Making dsDNA Using Primer Dimers
- Clean and Concentrate DNA with spin column (after PCR, before digestion)
- Colony PCR to Screen for Successful Ligations
- PCR Primers VF2 = tgccacctgacgtctaagaa VR primer = attaccgcctttgagtgagc
- Golden Gate Assembly protocol
- How many clones should I screen?
- TAS2R38 PCR amplification
F. Expression of Phenotypes
- Using degradation tags on proteins such as GFP
- Genomic Insertion Protocol
- M9CA media (J864-100G from Amresco) + 2mM MgSO4 (2mL/L of 1 M MgSO4) + 0.1 mM CaCl2 (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
- When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is 2 mg/mL in 50% EtOH, which is a 10,000X stock solution. Working concentration should 200 ng/mL.
- When inducing with IPTG, use 3 µL of stock (0.2 g/mL = 20% w/v) to every 1 mL of LB or other liquid.
- When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
- When inducing with 3OC6 (HSL), use a 2000 fold dilution of a 10 mg/mL stock solution. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
- When growing thyA- cells, add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
- List of auto-inducers and their catalog numbers
- Synergy Machine Protocol
G. Golden Gate Shuffling
H. Computer Tools We Use
- Optimize your Gel
- Gene Design (Boeke Lab at JHU)
- Gene Splitting Web Site
- PCR Primers w/ BioBricks
- Promega Tm Calculator
- NEB Phusion Tm Calculator
- Oligator making dsDNA from oligos
- The Loligator
- How many clones should I screen?
- Lance-olator Oligos for dsDNA assembly old version, we recommend Oligator now
- Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks
- Sequencing at MWG Operon
- Sequencing at Agencourt Bioscience
- Sequencing at CUGI
- Analyzing Sequences with ApE
- Using Apes (A Plasmid Editor)
- VeriPart for DNA sequences of Registry Parts
- The Optimus for optimizing codons
- Wiser Optimizer Not working right now
- GGAJET Junction Deign Tool
- GGA Primer Pairs Designed for You
I. Making Selective Media
Bio113 Lab Protocols
General Lab Resources
Discovering New Promoters with Synthetic Biology
- pClone Basic receiving plasmid for GGA
- pClone Green receiving plasmid for GGA
- understanding GGA and removal of transcriptional terminator (TT)
- Golden Gate Assembly for Bio113
- Building dsDNA with Oligos
- Promega Tm Calculator
- The Loligator
- Ligation Protocol
- Zippy Transformation
- Synergy Machine Protocol
- Colony PCR to verify successful GGA
- Optimize your Gel
- Pouring an agarose gel
- Calculate MWs
- 1kb Plus MW markers
- Ethanol Precipitate to clean DNA (alternative protocol to spin column)
- Registry of Standardized DNA Parts hosted by iGEM
- Registry of Functional Promoters hosted at Davidson College
TAS2R38 Allele Testing
- isolate genomic DNA from a single hair follicle
- TAS2R38 PCR amplification
- Setting up PCR mixtures
- Promega Tm Calculator
- PCR and Mg2+ concentration
- Prepare PCR product for sequencing (for Bio113 lab use)
- Sequencing at MWG Operon
- Analyzing Sequences with ApE
- Using Apes (A Plasmid Editor)
Evolution of Antibiotic Resistance