Davidson Protocols

A. General Lab Information

1. How to Keep a Lab Notebook
2. Common molecular reagents
3. Open Access Libraries
4. Standard Assembly
5. BioBrick Ends
6. Compatibility of Plasmids
7. Ethanol Precipitate to clean DNA (short protocol)
8. glycerolstocks How to Make Glycerol Stocks of Bacteria
9. Pipet Tip Olympic Records

B. Gel Electrophoresis and Purification

1. Pouring an agarose gel
2. Calculate MWs
3. 1kb Plus MW markers
4. Macherey-Nagel Gel Purification (improved 260/230 ratios)l
5. Qiagen QIAquick Gel Purification
6. Qiagen QIAquick Column Regeneration Protocol
7. ElectroElute Gel Purification

C. Digestion, Ligation, Transformation

1. Digest DNA with restriction enzymes
2. Double Digest Guide
3. NEB Double Digestion Guide
4. Shrimp Alkaline Phosphatase
5. Ligation Protocol
6. Choices for Transformation: Heat Shock vs. Zyppy
7. Heat Shock Transformation OR Short version of Heat Shock
8. Zippy Transformation
9. TSS Competent Cell Transformation
10. Golden Gate Assembly protocol (GGA with BsaI)
11. Golden_Gate_Assembly_Protocol_for_BsmB1 (GGA with BsmBI) written by collaborators at MWSU
12. GGA for BsmBI modified to do everything in one tube
13. NEB GGA Assembler
14. Electroporation_Transformation written by collaborators at MWSU
15. Electroporation - Campbell Old School Method

D. Minipreps

1. Choices for Mini-Preps: Promega vs. Zyppy
2. Promega miniprep
3. Zippy Miniprep

E. Making New Parts and PCR

1. Building dsDNA with Oligos
2. Annealing_Oligos_for_Cloning Calculate how to mix boiled oligos with 50 ng of receiving plasmid.
3. Cooled Oligos for GGA
4. The Loligator
5. Setting up PCR mixtures
6. LongAmp PCR NEB How to set up LongAmp PCR
7. Q5 PCR NEB How to set up Q5 High-Fidelity PCR
8. PCR and Mg²⁺ concentration
9. isolate genomic DNA from a single hair follicle
10. Prepare PCR product for sequencing after clean and concentration procedure (for Bio113 lab use)
11. Making dsDNA Using Primer Dimers
12. Clean and Concentrate DNA with spin column (after PCR, before digestion)
13. Colony PCR to Screen for Successful Ligations
14. PCR Primers VF2 = tgccacctgacgtctaagaa VR primer = attaccgcctttgagtgagc
15. Golden Gate Assembly protocol
16. How many clones should I screen?
17. TAS2R38 PCR amplification

F. Expression of Phenotypes

1. Using degradation tags on proteins such as GFP
2. Genomic Insertion Protocol
3. M9CA media (J864-100G from Amresco) + 2mM MgSO₄ (2mL/L of 1 M MgSO₄) + 0.1 mM CaCl₂ (0.1 mL/L 1 M CaCl₂) and optional 0.2% glucose (10 mL/L 20% stock solution).
4. When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is 2 mg/mL in 50% EtOH, which is a 10,000X stock solution. Working concentration should 200 ng/mL.
5. When inducing with IPTG, use 3 µL of stock (0.2 g/mL = 20% w/v) to every 1 mL of LB or other liquid.
6. When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
7. When inducing with 3OC6 (HSL), use a 2000 fold dilution of a 10 mg/mL stock solution. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
8. When growing thyA- cells, add 50 µg/mL thymine to your media. Our thyA- cells have a Kan^R resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
9. When using theophylline with riboswitch C, make a 40 mM stock solution of theophylline in 50 mM NaOH. The final concentration of theophylline should be 2 µM.
10. List of auto-inducers and their catalog numbers
11. Synergy Machine Protocol
12. M13 Bacteriophage Production Protocol

G. Golden Gate Shuffling

1. Media:DNAShuffling.docx
   

H. Computer Tools We Use

1. Optimize your Gel
2. Gene Design (Boeke Lab at JHU)
3. Gene Splitting Web Site
4. PCR Primers w/ BioBricks
5. Promega T_m Calculator
6. NEB Phusion T_m Calculator
7. Oligator making dsDNA from oligos
8. The Loligator
9. How many clones should I screen?
10. Lance-olator Oligos for dsDNA assembly old version, we recommend Oligator now
11. Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks
12. Sequencing at MWG Operon
13. Sequencing at Agencourt Bioscience
14. Sequencing at CUGI
15. Analyzing Sequences with ApE
16. Using Apes (A Plasmid Editor)
17. VeriPart for DNA sequences of Registry Parts
18. The Optimus for optimizing codons
19. Wiser Optimizer Not working right now
20. GGAJET Junction Deign Tool
21. GGA Primer Pairs Designed for You

I. Making Selective Media

1. Selecting for Tetracycline Sensitive E. coli

Bio113 Lab Protocols

General Lab Resources

1. How to Keep a Lab Notebook
2. Open Access Libraries

Discovering New Promoters with Synthetic Biology

1. pClone Basic receiving plasmid for GGA
2. pClone Green receiving plasmid for GGA
3. understanding GGA and removal of transcriptional terminator (TT)
4. Golden Gate Assembly for Bio113
5. Building dsDNA with Oligos
6. Promega T_m Calculator
7. The Loligator
8. Ligation Protocol
9. Zippy Transformation
10. Synergy Machine Protocol
11. Colony PCR to verify successful GGA
12. Optimize your Gel
13. Pouring an agarose gel
14. Calculate MWs
15. 1kb Plus MW markers
16. Ethanol Precipitate to clean DNA (alternative protocol to spin column)
17. Registry of Standardized DNA Parts hosted by iGEM
18. Registry of Functional Promoters hosted at Davidson College

TAS2R38 Allele Testing

1. isolate genomic DNA from a single hair follicle
2. TAS2R38 PCR amplification
3. Setting up PCR mixtures
4. Promega T_m Calculator
5. PCR and Mg²⁺ concentration
6. Prepare PCR product for sequencing (for Bio113 lab use)
7. Sequencing at MWG Operon
8. Analyzing Sequences with ApE
9. Using Apes (A Plasmid Editor)

Evolution of Antibiotic Resistance

1. glycerolstocks How to Make Glycerol Stocks of Bacteria