Difference between revisions of "Davidson Protocols"

From GcatWiki
Jump to: navigation, search
 
(16 intermediate revisions by 6 users not shown)
Line 34: Line 34:
 
# [https://goldengate.neb.com/editor NEB GGA Assembler]
 
# [https://goldengate.neb.com/editor NEB GGA Assembler]
 
# [[Electroporation_Transformation]] written by collaborators at MWSU
 
# [[Electroporation_Transformation]] written by collaborators at MWSU
 +
# [[Electroporation - Campbell Old School Method]]
  
 
'''D. Minipreps'''
 
'''D. Minipreps'''
Line 46: Line 47:
 
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
 
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
 
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
 
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
−
#[[LongAmp_PCR_NEB]] '''How to set up LongAmp PCR'''
+
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
 +
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
 
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg<sup>2+</sup> concentration]
 
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg<sup>2+</sup> concentration]
 
# [[isolate genomic DNA from a single hair follicle]]
 
# [[isolate genomic DNA from a single hair follicle]]
Line 67: Line 69:
 
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.  
 
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.  
 
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a Kan<sup>R</sup> resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.  
 
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a Kan<sup>R</sup> resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.  
 +
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 mM. It works best to make LB media with theophylline in it prior to autoclaving. This way you can avoid the NaOH.
 
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
 
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
 
# [[Synergy Machine Protocol]]
 
# [[Synergy Machine Protocol]]
 +
# [[M13 Bacteriophage Production Protocol]]
  
 
'''G. Golden Gate Shuffling'''
 
'''G. Golden Gate Shuffling'''
Line 95: Line 99:
 
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
 
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
 
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
 
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
 +
# [http://gcat.davidson.edu/SynBio18/REmbedder/rembedder.html REmbedder (insert restriction site without changing amino acids)]
 +
# [[Common Restriction Sites]]
 +
# [http://gcat.davidson.edu/SynBio18/StickyEndSelector/StickyEndSelector.html Sticky End Selector] to optimize unique sticky ends for correct cloning of fragments
 +
# [http://gcat.davidson.edu/SynBio18/ProteasePicker/ProteasePicker.html Protease Picker] for selecting which protease you want to use to produce desirable fragments
  
 
'''I. Making Selective Media'''
 
'''I. Making Selective Media'''
 
#[[Selecting for Tetracycline Sensitive E. coli]]
 
#[[Selecting for Tetracycline Sensitive E. coli]]
 +
 +
'''J Yeast Protocols'''
 +
#[[Yeast Media]]
 +
#[[Yeast Transformation]]
  
 
==Bio113 Lab Protocols==
 
==Bio113 Lab Protocols==

Latest revision as of 21:24, 24 September 2019

A. General Lab Information

  1. How to Keep a Lab Notebook
  2. Common molecular reagents
  3. Open Access Libraries
  4. Standard Assembly
  5. BioBrick Ends
  6. Compatibility of Plasmids
  7. Ethanol Precipitate to clean DNA (short protocol)
  8. glycerolstocks How to Make Glycerol Stocks of Bacteria
  9. Pipet Tip Olympic Records

B. Gel Electrophoresis and Purification

  1. Pouring an agarose gel
  2. Calculate MWs
  3. 1kb Plus MW markers
  4. Macherey-Nagel Gel Purification (improved 260/230 ratios)l
  5. Qiagen QIAquick Gel Purification
  6. Qiagen QIAquick Column Regeneration Protocol
  7. ElectroElute Gel Purification

C. Digestion, Ligation, Transformation

  1. Digest DNA with restriction enzymes
  2. Double Digest Guide
  3. NEB Double Digestion Guide
  4. Shrimp Alkaline Phosphatase
  5. Ligation Protocol
  6. Choices for Transformation: Heat Shock vs. Zyppy
  7. Heat Shock Transformation OR Short version of Heat Shock
  8. Zippy Transformation
  9. TSS Competent Cell Transformation
  10. Golden Gate Assembly protocol (GGA with BsaI)
  11. Golden_Gate_Assembly_Protocol_for_BsmB1 (GGA with BsmBI) written by collaborators at MWSU
  12. GGA for BsmBI modified to do everything in one tube
  13. NEB GGA Assembler
  14. Electroporation_Transformation written by collaborators at MWSU
  15. Electroporation - Campbell Old School Method

D. Minipreps

  1. Choices for Mini-Preps: Promega vs. Zyppy
  2. Promega miniprep
  3. Zippy Miniprep

E. Making New Parts and PCR

  1. Building dsDNA with Oligos
  2. Annealing_Oligos_for_Cloning Calculate how to mix boiled oligos with 50 ng of receiving plasmid.
  3. Cooled Oligos for GGA
  4. The Loligator
  5. Setting up PCR mixtures
  6. LongAmp PCR NEB How to set up LongAmp PCR
  7. Q5 PCR NEB How to set up Q5 High-Fidelity PCR
  8. PCR and Mg2+ concentration
  9. isolate genomic DNA from a single hair follicle
  10. Prepare PCR product for sequencing after clean and concentration procedure (for Bio113 lab use)
  11. Making dsDNA Using Primer Dimers
  12. Clean and Concentrate DNA with spin column (after PCR, before digestion)
  13. Colony PCR to Screen for Successful Ligations
  14. PCR Primers VF2 = tgccacctgacgtctaagaa VR primer = attaccgcctttgagtgagc
  15. Golden Gate Assembly protocol
  16. How many clones should I screen?
  17. TAS2R38 PCR amplification

F. Expression of Phenotypes

  1. Using degradation tags on proteins such as GFP
  2. Genomic Insertion Protocol
  3. M9CA media (J864-100G from Amresco) + 2mM MgSO4 (2mL/L of 1 M MgSO4) + 0.1 mM CaCl2 (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
  4. When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is 2 mg/mL in 50% EtOH, which is a 10,000X stock solution. Working concentration should 200 ng/mL.
  5. When inducing with IPTG, use 3 µL of stock (0.2 g/mL = 20% w/v) to every 1 mL of LB or other liquid.
  6. When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
  7. When inducing with 3OC6 (HSL), use a 2000 fold dilution of a 10 mg/mL stock solution. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
  8. When growing thyA- cells, add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
  9. When using theophylline with riboswitch C, make a 40-100 mM stock solution of theophylline in 50 mM NaOH. The final concentration of theophylline should be 2 mM. It works best to make LB media with theophylline in it prior to autoclaving. This way you can avoid the NaOH.
  10. List of auto-inducers and their catalog numbers
  11. Synergy Machine Protocol
  12. M13 Bacteriophage Production Protocol

G. Golden Gate Shuffling

  1. Media:DNAShuffling.docx

H. Computer Tools We Use

  1. Optimize your Gel
  2. Gene Design (Boeke Lab at JHU)
  3. Gene Splitting Web Site
  4. PCR Primers w/ BioBricks
  5. Promega Tm Calculator
  6. NEB Phusion Tm Calculator
  7. Oligator making dsDNA from oligos
  8. The Loligator
  9. How many clones should I screen?
  10. Lance-olator Oligos for dsDNA assembly old version, we recommend Oligator now
  11. Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks
  12. Sequencing at MWG Operon
  13. Sequencing at Agencourt Bioscience
  14. Sequencing at CUGI
  15. Analyzing Sequences with ApE
  16. Using Apes (A Plasmid Editor)
  17. VeriPart for DNA sequences of Registry Parts
  18. The Optimus for optimizing codons
  19. Wiser Optimizer Not working right now
  20. GGAJET Junction Deign Tool
  21. GGA Primer Pairs Designed for You
  22. REmbedder (insert restriction site without changing amino acids)
  23. Common Restriction Sites
  24. Sticky End Selector to optimize unique sticky ends for correct cloning of fragments
  25. Protease Picker for selecting which protease you want to use to produce desirable fragments

I. Making Selective Media

  1. Selecting for Tetracycline Sensitive E. coli

J Yeast Protocols

  1. Yeast Media
  2. Yeast Transformation

Bio113 Lab Protocols

General Lab Resources

  1. How to Keep a Lab Notebook
  2. Open Access Libraries


Discovering New Promoters with Synthetic Biology

  1. pClone Basic receiving plasmid for GGA
  2. pClone Green receiving plasmid for GGA
  3. understanding GGA and removal of transcriptional terminator (TT)
  4. Golden Gate Assembly for Bio113
  5. Building dsDNA with Oligos
  6. Promega Tm Calculator
  7. The Loligator
  8. Ligation Protocol
  9. Zippy Transformation
  10. Synergy Machine Protocol
  11. Colony PCR to verify successful GGA
  12. Optimize your Gel
  13. Pouring an agarose gel
  14. Calculate MWs
  15. 1kb Plus MW markers
  16. Ethanol Precipitate to clean DNA (alternative protocol to spin column)
  17. Registry of Standardized DNA Parts hosted by iGEM
  18. Registry of Functional Promoters hosted at Davidson College


TAS2R38 Allele Testing

  1. isolate genomic DNA from a single hair follicle
  2. TAS2R38 PCR amplification
  3. Setting up PCR mixtures
  4. Promega Tm Calculator
  5. PCR and Mg2+ concentration
  6. Prepare PCR product for sequencing (for Bio113 lab use)
  7. Sequencing at MWG Operon
  8. Analyzing Sequences with ApE
  9. Using Apes (A Plasmid Editor)


Evolution of Antibiotic Resistance

  1. glycerolstocks How to Make Glycerol Stocks of Bacteria